Incidental Mutation 'R3551:Aqp7'
ID268329
Institutional Source Beutler Lab
Gene Symbol Aqp7
Ensembl Gene ENSMUSG00000028427
Gene Nameaquaporin 7
SynonymsAQPap, AQP7L
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41033074-41048139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41045329 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 17 (N17I)
Ref Sequence ENSEMBL: ENSMUSP00000093007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030136] [ENSMUST00000054945]
Predicted Effect probably benign
Transcript: ENSMUST00000030136
AA Change: N17I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030136
Gene: ENSMUSG00000028427
AA Change: N17I

DomainStartEndE-ValueType
Pfam:MIP 12 257 7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054945
AA Change: N17I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093007
Gene: ENSMUSG00000028427
AA Change: N17I

DomainStartEndE-ValueType
Pfam:MIP 12 257 1.6e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157529
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aquaporin family of water-selective membrane channels. The encoded protein localizes to the plasma membrane and allows movement of water, glycerol and urea across cell membranes. This gene is highly expressed in the adipose tissue where the encoded protein facilitates efflux of glycerol. In the proximal straight tubules of kidney, the encoded protein is localized to the apical membrane and prevents excretion of glycerol into urine. The encoded protein is present in spermatids, as well as in the testicular and epididymal spermatozoa suggesting an important role in late spermatogenesis. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related aquaporin gene on chromosome 9. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice for one allele show decreased circulating glycerol levels and fasting hypoglycemia. Other mutant alleles show increased gonadal fat pad mass and adipocyte hypertrophy or increased urine glucose and impaired water permeability in the kidney, but have normal serum glycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Aqp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Aqp7 APN 4 41045321 nonsense probably null
IGL01871:Aqp7 APN 4 41045321 nonsense probably null
IGL02173:Aqp7 APN 4 41034379 nonsense probably null
IGL03139:Aqp7 APN 4 41045326 missense probably benign 0.00
IGL03237:Aqp7 APN 4 41034884 missense possibly damaging 0.68
IGL03241:Aqp7 APN 4 41045270 splice site probably benign
acadia UTSW 4 41035510 missense probably benign 0.00
IGL03055:Aqp7 UTSW 4 41045326 missense probably benign 0.00
R0884:Aqp7 UTSW 4 41034929 missense possibly damaging 0.86
R1617:Aqp7 UTSW 4 41036109 missense probably null 0.74
R5340:Aqp7 UTSW 4 41034347 missense probably benign
R5689:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5690:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5691:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5692:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5710:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5711:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5713:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5751:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5817:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5820:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5921:Aqp7 UTSW 4 41036093 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCCTCTGACTCCACTCTA -3'
(R):5'- AGAGGCACCTGGGTTACCC -3'

Sequencing Primer
(F):5'- CTCTATCCCAAAAAGACTTGATGAGG -3'
(R):5'- GGGTTACCCATTAACTCAGCCATG -3'
Posted On2015-02-19