Incidental Mutation 'R3551:Ptpn12'
ID268330
Institutional Source Beutler Lab
Gene Symbol Ptpn12
Ensembl Gene ENSMUSG00000028771
Gene Nameprotein tyrosine phosphatase, non-receptor type 12
SynonymsP19-PTP, PTP-PEST, PTP-P19
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location20986645-21055911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20989049 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 742 (K742E)
Ref Sequence ENSEMBL: ENSMUSP00000030556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030556
AA Change: K742E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: K742E

DomainStartEndE-ValueType
PTPc 27 295 2.14e-126 SMART
Blast:PTPc 338 399 7e-12 BLAST
low complexity region 499 518 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
low complexity region 622 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151366
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Ptpn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ptpn12 APN 5 21029850 missense probably damaging 1.00
IGL00226:Ptpn12 APN 5 20998668 missense probably damaging 1.00
IGL01432:Ptpn12 APN 5 20998555 nonsense probably null
IGL02285:Ptpn12 APN 5 21055713 missense probably benign 0.40
IGL02488:Ptpn12 APN 5 21022062 missense possibly damaging 0.72
IGL02550:Ptpn12 APN 5 20998139 missense probably benign 0.00
IGL02640:Ptpn12 APN 5 21019246 missense probably damaging 1.00
IGL02652:Ptpn12 APN 5 21002437 missense probably benign 0.04
IGL03130:Ptpn12 APN 5 21002612 unclassified probably benign
R0531:Ptpn12 UTSW 5 20998483 missense possibly damaging 0.53
R0948:Ptpn12 UTSW 5 20998043 missense probably benign
R1018:Ptpn12 UTSW 5 21029869 missense possibly damaging 0.94
R1184:Ptpn12 UTSW 5 20998356 missense possibly damaging 0.86
R1699:Ptpn12 UTSW 5 20998170 missense probably benign 0.01
R1938:Ptpn12 UTSW 5 20993263 missense probably damaging 1.00
R1952:Ptpn12 UTSW 5 20998310 missense probably benign 0.34
R2152:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2153:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2154:Ptpn12 UTSW 5 21002468 missense probably damaging 1.00
R2267:Ptpn12 UTSW 5 20998411 missense probably damaging 0.98
R2358:Ptpn12 UTSW 5 20998692 missense probably damaging 1.00
R3931:Ptpn12 UTSW 5 21001323 missense probably benign 0.00
R4013:Ptpn12 UTSW 5 20992743 missense probably benign 0.05
R4039:Ptpn12 UTSW 5 21002510 nonsense probably null
R4501:Ptpn12 UTSW 5 21019280 missense probably damaging 1.00
R4748:Ptpn12 UTSW 5 21005385 nonsense probably null
R4754:Ptpn12 UTSW 5 20998589 missense probably benign 0.34
R4963:Ptpn12 UTSW 5 21015708 splice site probably null
R5160:Ptpn12 UTSW 5 20997831 missense probably damaging 1.00
R5581:Ptpn12 UTSW 5 21015726 missense probably damaging 1.00
R5789:Ptpn12 UTSW 5 20989015 missense possibly damaging 0.92
R5836:Ptpn12 UTSW 5 21009546 nonsense probably null
R6383:Ptpn12 UTSW 5 20987468 nonsense probably null
R6883:Ptpn12 UTSW 5 21055713 missense probably benign 0.40
R7544:Ptpn12 UTSW 5 21009511 missense probably damaging 1.00
R7885:Ptpn12 UTSW 5 20998525 missense possibly damaging 0.54
R8032:Ptpn12 UTSW 5 20998043 missense probably benign
R8224:Ptpn12 UTSW 5 20998658 missense probably damaging 1.00
X0004:Ptpn12 UTSW 5 21019296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAGACATTACCTCAGAGTAAAGAG -3'
(R):5'- TCTCTAGGAAAGACAACCATAAGG -3'

Sequencing Primer
(F):5'- TGGACCTAAGAAGCAAGCTTG -3'
(R):5'- CTGCCTTAACGATGGTGA -3'
Posted On2015-02-19