Mutagenetix > Incidental Mutation

Incidental Mutation 'R3551:Ptpn12'

268330

Institutional Source

Beutler Lab

Gene Symbol

Ptpn12

Ensembl Gene

ENSMUSG00000028771

Gene Name

protein tyrosine phosphatase, non-receptor type 12

Synonyms

P19-PTP, PTP-PEST, PTP-P19

MMRRC Submission

040668-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3551 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20986645-21055911 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20989049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 742 (K742E)

Ref Sequence

ENSEMBL: ENSMUSP00000030556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030556]

AlphaFold

P35831

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030556
AA Change: K742E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000030556
Gene: ENSMUSG00000028771
AA Change: K742E

Domain	Start	End	E-Value	Type
PTPc	27	295	2.14e-126	SMART
Blast:PTPc	338	399	7e-12	BLAST
low complexity region	499	518	N/A	INTRINSIC
low complexity region	603	615	N/A	INTRINSIC
low complexity region	622	640	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151366

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may regulate protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of the oncogene c-ABL and thus may play a role in oncogenesis. This PTP was also shown to interact with, and dephosphorylate, various products related to cytoskeletal structure and cell adhesion, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin. This suggests it has a regulatory role in controlling cell shape and mobility. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality, defective embryo turning, improper somitogenesis and vasculogenesis, impaired liver development, truncation of the caudal region and mesenchyme deficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	A	11: 84,261,624	Y866N	probably damaging	Het
Adam24	G	C	8: 40,679,593	W33C	probably benign	Het
Adgrl2	A	T	3: 148,858,963	V327E	probably damaging	Het
Aqp7	T	A	4: 41,045,329	N17I	probably benign	Het
Bicra	T	A	7: 15,979,733	Q848L	probably benign	Het
C4b	T	C	17: 34,741,872	E240G	possibly damaging	Het
Ccni	T	C	5: 93,187,761	S173G	probably benign	Het
Clca3a2	T	A	3: 144,803,081	N50I	probably damaging	Het
Dcaf7	A	G	11: 106,054,796	T324A	probably benign	Het
Dnah12	G	A	14: 26,770,972	R1230H	probably benign	Het
Dsg4	G	A	18: 20,451,756	V176M	probably damaging	Het
Ect2l	A	G	10: 18,163,393	I339T	probably damaging	Het
Edc4	A	T	8: 105,885,494	I138F	probably damaging	Het
Ercc6l2	T	A	13: 63,844,595	V401E	probably damaging	Het
Gm3269	T	A	14: 4,845,893	V260D	possibly damaging	Het
Gm4076	C	T	13: 85,127,150		noncoding transcript	Het
Gm4922	A	T	10: 18,784,496	N159K	probably benign	Het
Gm5134	G	T	10: 76,000,447	A421S	probably benign	Het
Gm5724	T	C	6: 141,708,596	K647E	probably benign	Het
Hrc	G	C	7: 45,336,333	E303Q	possibly damaging	Het
Ipo4	A	G	14: 55,633,103	V288A	probably benign	Het
Kng2	A	G	16: 23,011,995		probably null	Het
Lrfn1	T	C	7: 28,460,054	L466P	possibly damaging	Het
Magi1	T	A	6: 93,699,629	K916N	probably damaging	Het
Mms19	T	C	19: 41,949,798	T720A	probably benign	Het
Muc5b	A	G	7: 141,861,335	T2673A	possibly damaging	Het
Myo15	C	T	11: 60,509,663	A1767V	possibly damaging	Het
Npas2	A	T	1: 39,287,562	M43L	probably benign	Het
Nup43	A	G	10: 7,675,014	D216G	possibly damaging	Het
Olfr378	T	C	11: 73,425,852	I44V	probably benign	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pcdhga6	G	T	18: 37,708,217	R330L	probably benign	Het
Pear1	A	G	3: 87,758,132	F145L	probably benign	Het
Pgap1	A	G	1: 54,530,143	S355P	possibly damaging	Het
Prr14l	A	T	5: 32,828,619		probably null	Het
Ryr1	T	A	7: 29,056,997	Q3464L	probably damaging	Het
Sema4c	G	C	1: 36,553,723	T138S	probably benign	Het
Slc4a2	C	T	5: 24,430,101	T168M	probably benign	Het
Spice1	G	T	16: 44,357,869	S85I	probably damaging	Het
Thrb	T	A	14: 17,963,214	I59N	probably damaging	Het
Trav7-1	A	G	14: 52,655,299	D103G	probably damaging	Het
Ubap2l	G	T	3: 90,015,451	T766N	unknown	Het
Zfp692	C	T	11: 58,309,428	T170I	possibly damaging	Het
Zfp704	A	G	3: 9,474,525	V255A	probably damaging	Het
Zfp759	T	C	13: 67,138,967	V194A	probably benign	Het

Other mutations in Ptpn12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Ptpn12	APN	5	21029850	missense	probably damaging	1.00
IGL00226:Ptpn12	APN	5	20998668	missense	probably damaging	1.00
IGL01432:Ptpn12	APN	5	20998555	nonsense	probably null
IGL02285:Ptpn12	APN	5	21055713	missense	probably benign	0.40
IGL02488:Ptpn12	APN	5	21022062	missense	possibly damaging	0.72
IGL02550:Ptpn12	APN	5	20998139	missense	probably benign	0.00
IGL02640:Ptpn12	APN	5	21019246	missense	probably damaging	1.00
IGL02652:Ptpn12	APN	5	21002437	missense	probably benign	0.04
IGL03130:Ptpn12	APN	5	21002612	unclassified	probably benign
R0531:Ptpn12	UTSW	5	20998483	missense	possibly damaging	0.53
R0948:Ptpn12	UTSW	5	20998043	missense	probably benign
R1018:Ptpn12	UTSW	5	21029869	missense	possibly damaging	0.94
R1184:Ptpn12	UTSW	5	20998356	missense	possibly damaging	0.86
R1699:Ptpn12	UTSW	5	20998170	missense	probably benign	0.01
R1938:Ptpn12	UTSW	5	20993263	missense	probably damaging	1.00
R1952:Ptpn12	UTSW	5	20998310	missense	probably benign	0.34
R2152:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2153:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2154:Ptpn12	UTSW	5	21002468	missense	probably damaging	1.00
R2267:Ptpn12	UTSW	5	20998411	missense	probably damaging	0.98
R2358:Ptpn12	UTSW	5	20998692	missense	probably damaging	1.00
R3931:Ptpn12	UTSW	5	21001323	missense	probably benign	0.00
R4013:Ptpn12	UTSW	5	20992743	missense	probably benign	0.05
R4039:Ptpn12	UTSW	5	21002510	nonsense	probably null
R4501:Ptpn12	UTSW	5	21019280	missense	probably damaging	1.00
R4748:Ptpn12	UTSW	5	21005385	nonsense	probably null
R4754:Ptpn12	UTSW	5	20998589	missense	probably benign	0.34
R4963:Ptpn12	UTSW	5	21015708	splice site	probably null
R5160:Ptpn12	UTSW	5	20997831	missense	probably damaging	1.00
R5581:Ptpn12	UTSW	5	21015726	missense	probably damaging	1.00
R5789:Ptpn12	UTSW	5	20989015	missense	possibly damaging	0.92
R5836:Ptpn12	UTSW	5	21009546	nonsense	probably null
R6383:Ptpn12	UTSW	5	20987468	nonsense	probably null
R6883:Ptpn12	UTSW	5	21055713	missense	probably benign	0.40
R7544:Ptpn12	UTSW	5	21009511	missense	probably damaging	1.00
R7885:Ptpn12	UTSW	5	20998525	missense	possibly damaging	0.54
R7915:Ptpn12	UTSW	5	21009451	missense	probably damaging	1.00
R7960:Ptpn12	UTSW	5	21055689	missense	probably benign	0.01
R7976:Ptpn12	UTSW	5	21002633	nonsense	probably null
R8032:Ptpn12	UTSW	5	20998043	missense	probably benign
R8224:Ptpn12	UTSW	5	20998658	missense	probably damaging	1.00
R8473:Ptpn12	UTSW	5	20998359	missense	probably benign	0.00
R8823:Ptpn12	UTSW	5	20998623	missense	probably damaging	1.00
R9375:Ptpn12	UTSW	5	21019214	missense	probably benign	0.21
R9613:Ptpn12	UTSW	5	20998623	missense	probably damaging	1.00
R9707:Ptpn12	UTSW	5	21002622	missense	probably damaging	0.99
X0004:Ptpn12	UTSW	5	21019296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATAGACATTACCTCAGAGTAAAGAG -3'
(R):5'- TCTCTAGGAAAGACAACCATAAGG -3'

Sequencing Primer
(F):5'- TGGACCTAAGAAGCAAGCTTG -3'
(R):5'- CTGCCTTAACGATGGTGA -3'

Posted On

2015-02-19