Incidental Mutation 'R3551:Gm5724'
ID268337
Institutional Source Beutler Lab
Gene Symbol Gm5724
Ensembl Gene ENSMUSG00000084927
Gene Namepredicted gene 5724
Synonyms
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141708118-141773810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141708596 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 647 (K647E)
Ref Sequence ENSEMBL: ENSMUSP00000117177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148411]
Predicted Effect probably benign
Transcript: ENSMUST00000148411
AA Change: K647E

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117177
Gene: ENSMUSG00000084927
AA Change: K647E

DomainStartEndE-ValueType
Pfam:MFS_1 22 405 3.4e-26 PFAM
KAZAL 438 484 1.71e0 SMART
Meta Mutation Damage Score 0.0831 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Gm5724
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Gm5724 APN 6 141754429 missense probably benign 0.14
IGL01347:Gm5724 APN 6 141754466 nonsense probably null
IGL01539:Gm5724 APN 6 141727607 missense possibly damaging 0.88
IGL01613:Gm5724 APN 6 141713214 missense possibly damaging 0.67
IGL02060:Gm5724 APN 6 141754408 missense probably benign 0.00
IGL02063:Gm5724 APN 6 141738889 missense probably benign 0.01
IGL02126:Gm5724 APN 6 141739013 missense probably benign 0.29
IGL02214:Gm5724 APN 6 141723185 missense possibly damaging 0.50
IGL02630:Gm5724 APN 6 141723110 missense probably damaging 1.00
R0966:Gm5724 UTSW 6 141727573 missense probably benign 0.00
R1082:Gm5724 UTSW 6 141712133 missense probably damaging 1.00
R1433:Gm5724 UTSW 6 141765703 missense probably benign 0.00
R1571:Gm5724 UTSW 6 141754409 nonsense probably null
R1765:Gm5724 UTSW 6 141754358 splice site probably benign
R2055:Gm5724 UTSW 6 141725455 missense probably benign 0.33
R2174:Gm5724 UTSW 6 141727593 nonsense probably null
R2495:Gm5724 UTSW 6 141765777 missense probably benign 0.02
R2857:Gm5724 UTSW 6 141744538 missense probably benign 0.35
R3824:Gm5724 UTSW 6 141754374 missense possibly damaging 0.50
R3912:Gm5724 UTSW 6 141727636 missense probably damaging 0.97
R3942:Gm5724 UTSW 6 141727714 missense probably damaging 0.98
R4161:Gm5724 UTSW 6 141708596 missense probably benign 0.20
R4168:Gm5724 UTSW 6 141738947 missense probably benign 0.03
R4395:Gm5724 UTSW 6 141712118 missense probably benign 0.02
R4720:Gm5724 UTSW 6 141723222 missense probably damaging 1.00
R4732:Gm5724 UTSW 6 141723179 missense probably benign 0.01
R4733:Gm5724 UTSW 6 141723179 missense probably benign 0.01
R4794:Gm5724 UTSW 6 141767562 missense probably benign 0.11
R5062:Gm5724 UTSW 6 141767454 missense possibly damaging 0.46
R5389:Gm5724 UTSW 6 141740467 missense probably benign 0.12
R5419:Gm5724 UTSW 6 141736100 splice site probably null
R5423:Gm5724 UTSW 6 141744462 missense probably damaging 1.00
R5704:Gm5724 UTSW 6 141713254 missense probably benign 0.00
R5973:Gm5724 UTSW 6 141754456 missense probably benign 0.01
R6041:Gm5724 UTSW 6 141739038 missense probably benign 0.11
R6284:Gm5724 UTSW 6 141725393 missense probably damaging 1.00
R6395:Gm5724 UTSW 6 141723092 splice site probably null
R6993:Gm5724 UTSW 6 141765742 missense possibly damaging 0.94
R7149:Gm5724 UTSW 6 141744452 missense probably damaging 1.00
R7159:Gm5724 UTSW 6 141773778 start codon destroyed probably damaging 1.00
R7627:Gm5724 UTSW 6 141744545 missense probably damaging 1.00
R7784:Gm5724 UTSW 6 141713193 critical splice donor site probably null
R7873:Gm5724 UTSW 6 141727722 missense probably benign 0.44
R7956:Gm5724 UTSW 6 141727722 missense probably benign 0.44
X0020:Gm5724 UTSW 6 141754365 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTCCATACAAGTCTTCCCTGGG -3'
(R):5'- AGCTTTCGCTGAACACATTAAG -3'

Sequencing Primer
(F):5'- GTCTTCCCTGGGAAAAATCTTAAGC -3'
(R):5'- AGATTTAATGCTGATGAGTTCTGTTC -3'
Posted On2015-02-19