Mutagenetix > Incidental Mutation

Incidental Mutation 'R3551:Bicra'

268338

Institutional Source

Beutler Lab

Gene Symbol

Bicra

Ensembl Gene

ENSMUSG00000070808

Gene Name

BRD4 interacting chromatin remodeling complex associated protein

Synonyms

Gltscr1

MMRRC Submission

040668-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R3551 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15970672-16047921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 15979733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 848 (Q848L)

Ref Sequence

ENSEMBL: ENSMUSP00000148012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]

AlphaFold

F8VPZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000094821
AA Change: Q848L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: Q848L

Domain	Start	End	E-Value	Type
low complexity region	86	96	N/A	INTRINSIC
low complexity region	140	155	N/A	INTRINSIC
internal_repeat_1	156	298	1.03e-6	PROSPERO
low complexity region	308	323	N/A	INTRINSIC
low complexity region	427	443	N/A	INTRINSIC
internal_repeat_1	479	614	1.03e-6	PROSPERO
low complexity region	619	638	N/A	INTRINSIC
low complexity region	642	676	N/A	INTRINSIC
low complexity region	719	732	N/A	INTRINSIC
low complexity region	756	782	N/A	INTRINSIC
low complexity region	790	819	N/A	INTRINSIC
low complexity region	827	843	N/A	INTRINSIC
low complexity region	852	906	N/A	INTRINSIC
low complexity region	940	950	N/A	INTRINSIC
low complexity region	987	1006	N/A	INTRINSIC
Pfam:GLTSCR1	1094	1202	4.6e-43	PFAM
low complexity region	1232	1251	N/A	INTRINSIC
low complexity region	1275	1294	N/A	INTRINSIC
low complexity region	1349	1371	N/A	INTRINSIC
low complexity region	1460	1473	N/A	INTRINSIC
low complexity region	1535	1555	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209251

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210035

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210713

Predicted Effect

probably benign
Transcript: ENSMUST00000210781
AA Change: Q848L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	A	11: 84,261,624	Y866N	probably damaging	Het
Adam24	G	C	8: 40,679,593	W33C	probably benign	Het
Adgrl2	A	T	3: 148,858,963	V327E	probably damaging	Het
Aqp7	T	A	4: 41,045,329	N17I	probably benign	Het
C4b	T	C	17: 34,741,872	E240G	possibly damaging	Het
Ccni	T	C	5: 93,187,761	S173G	probably benign	Het
Clca3a2	T	A	3: 144,803,081	N50I	probably damaging	Het
Dcaf7	A	G	11: 106,054,796	T324A	probably benign	Het
Dnah12	G	A	14: 26,770,972	R1230H	probably benign	Het
Dsg4	G	A	18: 20,451,756	V176M	probably damaging	Het
Ect2l	A	G	10: 18,163,393	I339T	probably damaging	Het
Edc4	A	T	8: 105,885,494	I138F	probably damaging	Het
Ercc6l2	T	A	13: 63,844,595	V401E	probably damaging	Het
Gm3269	T	A	14: 4,845,893	V260D	possibly damaging	Het
Gm4076	C	T	13: 85,127,150		noncoding transcript	Het
Gm4922	A	T	10: 18,784,496	N159K	probably benign	Het
Gm5134	G	T	10: 76,000,447	A421S	probably benign	Het
Gm5724	T	C	6: 141,708,596	K647E	probably benign	Het
Hrc	G	C	7: 45,336,333	E303Q	possibly damaging	Het
Ipo4	A	G	14: 55,633,103	V288A	probably benign	Het
Kng2	A	G	16: 23,011,995		probably null	Het
Lrfn1	T	C	7: 28,460,054	L466P	possibly damaging	Het
Magi1	T	A	6: 93,699,629	K916N	probably damaging	Het
Mms19	T	C	19: 41,949,798	T720A	probably benign	Het
Muc5b	A	G	7: 141,861,335	T2673A	possibly damaging	Het
Myo15	C	T	11: 60,509,663	A1767V	possibly damaging	Het
Npas2	A	T	1: 39,287,562	M43L	probably benign	Het
Nup43	A	G	10: 7,675,014	D216G	possibly damaging	Het
Olfr378	T	C	11: 73,425,852	I44V	probably benign	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pcdhga6	G	T	18: 37,708,217	R330L	probably benign	Het
Pear1	A	G	3: 87,758,132	F145L	probably benign	Het
Pgap1	A	G	1: 54,530,143	S355P	possibly damaging	Het
Prr14l	A	T	5: 32,828,619		probably null	Het
Ptpn12	T	C	5: 20,989,049	K742E	possibly damaging	Het
Ryr1	T	A	7: 29,056,997	Q3464L	probably damaging	Het
Sema4c	G	C	1: 36,553,723	T138S	probably benign	Het
Slc4a2	C	T	5: 24,430,101	T168M	probably benign	Het
Spice1	G	T	16: 44,357,869	S85I	probably damaging	Het
Thrb	T	A	14: 17,963,214	I59N	probably damaging	Het
Trav7-1	A	G	14: 52,655,299	D103G	probably damaging	Het
Ubap2l	G	T	3: 90,015,451	T766N	unknown	Het
Zfp692	C	T	11: 58,309,428	T170I	possibly damaging	Het
Zfp704	A	G	3: 9,474,525	V255A	probably damaging	Het
Zfp759	T	C	13: 67,138,967	V194A	probably benign	Het

Other mutations in Bicra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Bicra	APN	7	15996577	missense	possibly damaging	0.70
IGL01521:Bicra	APN	7	15989188	missense	probably benign	0.18
IGL01690:Bicra	APN	7	15987753	missense	probably benign	0.09
IGL01721:Bicra	APN	7	15988699	missense	probably benign
IGL01994:Bicra	APN	7	15972816	missense	possibly damaging	0.46
IGL02084:Bicra	APN	7	15987738	missense	probably benign	0.09
IGL02312:Bicra	APN	7	15993141	missense	possibly damaging	0.85
IGL02686:Bicra	APN	7	15987915	missense	probably benign	0.02
IGL02727:Bicra	APN	7	15979465	missense	possibly damaging	0.95
IGL03031:Bicra	APN	7	15975801	missense	probably benign	0.16
R0003:Bicra	UTSW	7	15971887	missense	probably benign
R0025:Bicra	UTSW	7	15987511	missense	possibly damaging	0.53
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0417:Bicra	UTSW	7	15972322	missense	probably damaging	1.00
R0437:Bicra	UTSW	7	15988762	missense	possibly damaging	0.73
R0547:Bicra	UTSW	7	15972248	missense	probably damaging	1.00
R0688:Bicra	UTSW	7	15989322	missense	probably damaging	1.00
R0855:Bicra	UTSW	7	15972004	missense	probably damaging	1.00
R1448:Bicra	UTSW	7	15988359	missense	possibly damaging	0.86
R1637:Bicra	UTSW	7	15972689	missense	probably benign	0.19
R1899:Bicra	UTSW	7	15987751	missense	possibly damaging	0.53
R2035:Bicra	UTSW	7	15996413	missense	possibly damaging	0.53
R2247:Bicra	UTSW	7	15989234	missense	probably benign	0.33
R2471:Bicra	UTSW	7	15972332	missense	probably benign	0.04
R2484:Bicra	UTSW	7	15988680	missense	possibly damaging	0.96
R3437:Bicra	UTSW	7	15989298	missense	possibly damaging	0.85
R4816:Bicra	UTSW	7	15988906	missense	possibly damaging	0.53
R4901:Bicra	UTSW	7	15987601	missense	possibly damaging	0.53
R5035:Bicra	UTSW	7	15979424	missense	possibly damaging	0.90
R5078:Bicra	UTSW	7	15975457	missense	probably damaging	1.00
R5094:Bicra	UTSW	7	15975371	missense	probably damaging	1.00
R5195:Bicra	UTSW	7	15979953	missense	possibly damaging	0.93
R5496:Bicra	UTSW	7	15987841	missense	probably benign	0.33
R5780:Bicra	UTSW	7	15979754	missense	possibly damaging	0.96
R6541:Bicra	UTSW	7	15979129	missense	probably benign	0.00
R6560:Bicra	UTSW	7	15989194	missense	possibly damaging	0.53
R6575:Bicra	UTSW	7	15979131	missense	probably benign	0.25
R6854:Bicra	UTSW	7	15988762	missense	probably benign	0.18
R6967:Bicra	UTSW	7	15972205	missense	probably damaging	0.97
R7283:Bicra	UTSW	7	15972500	missense	probably damaging	1.00
R7454:Bicra	UTSW	7	15972134	missense	probably benign	0.30
R7462:Bicra	UTSW	7	15979135	missense	possibly damaging	0.84
R7488:Bicra	UTSW	7	15989442	critical splice acceptor site	probably null
R7506:Bicra	UTSW	7	15988213	missense	possibly damaging	0.96
R7534:Bicra	UTSW	7	15971935	missense	probably damaging	0.98
R7915:Bicra	UTSW	7	15988522	missense	probably benign
R8063:Bicra	UTSW	7	15979044	missense	probably benign
R8147:Bicra	UTSW	7	15988470	missense	possibly damaging	0.93
R8699:Bicra	UTSW	7	15989188	missense	probably benign	0.18
R8784:Bicra	UTSW	7	15971950	missense	probably damaging	1.00
R8859:Bicra	UTSW	7	15987812	missense	possibly damaging	0.73
R8971:Bicra	UTSW	7	15987556	missense	probably benign	0.08
R9487:Bicra	UTSW	7	15971792	missense	probably damaging	0.99
R9614:Bicra	UTSW	7	15971955	missense	probably damaging	1.00
R9721:Bicra	UTSW	7	15979176	missense	probably damaging	1.00
R9777:Bicra	UTSW	7	15972062	missense	probably benign	0.09
X0064:Bicra	UTSW	7	15975775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTACCATCTGGAAGGTCCG -3'
(R):5'- TGCAGCTGCTCCACTGAAAG -3'

Sequencing Primer
(F):5'- CAACCTGGCAGAAGGCTCAG -3'
(R):5'- TGCTCCACTGAAAGCCCCTG -3'

Posted On

2015-02-19