Incidental Mutation 'R3551:Adam24'
ID268343
Institutional Source Beutler Lab
Gene Symbol Adam24
Ensembl Gene ENSMUSG00000046723
Gene Namea disintegrin and metallopeptidase domain 24 (testase 1)
SynonymsDtgn5
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40675077-40682199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 40679593 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 33 (W33C)
Ref Sequence ENSEMBL: ENSMUSP00000050727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051614]
Predicted Effect probably benign
Transcript: ENSMUST00000051614
AA Change: W33C

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050727
Gene: ENSMUSG00000046723
AA Change: W33C

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 160 3.3e-14 PFAM
Pfam:Reprolysin_2 193 389 6.3e-13 PFAM
Pfam:Reprolysin 208 398 7.8e-43 PFAM
Pfam:Reprolysin_5 209 382 3e-17 PFAM
Pfam:Reprolysin_4 209 392 4.9e-13 PFAM
Pfam:Reprolysin_3 232 353 9.9e-16 PFAM
DISIN 415 491 7.13e-39 SMART
ACR 492 628 7.74e-69 SMART
transmembrane domain 698 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210267
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Male mice lacking the encoded protein exhibit reduced fertility due to the higher incidence of polyspermic embryos. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Males homozygous for a targeted null mutation are subfertile and produce an increased number of polyspermic embryos at the pronuclear stage. Female homozygotes show normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Adam24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Adam24 APN 8 40679532 missense probably benign 0.41
IGL02517:Adam24 APN 8 40680179 missense probably damaging 1.00
R0195:Adam24 UTSW 8 40681766 missense probably benign 0.00
R1067:Adam24 UTSW 8 40680754 nonsense probably null
R1180:Adam24 UTSW 8 40681428 missense probably damaging 1.00
R1438:Adam24 UTSW 8 40681392 missense probably benign 0.19
R1741:Adam24 UTSW 8 40679603 missense probably benign 0.00
R1779:Adam24 UTSW 8 40680965 missense possibly damaging 0.83
R1940:Adam24 UTSW 8 40681361 nonsense probably null
R2228:Adam24 UTSW 8 40680365 missense probably benign 0.00
R2229:Adam24 UTSW 8 40680365 missense probably benign 0.00
R2265:Adam24 UTSW 8 40680071 missense possibly damaging 0.95
R2359:Adam24 UTSW 8 40680945 missense possibly damaging 0.91
R3837:Adam24 UTSW 8 40680545 missense probably benign
R4834:Adam24 UTSW 8 40679699 missense probably damaging 1.00
R5121:Adam24 UTSW 8 40679511 missense probably damaging 1.00
R5410:Adam24 UTSW 8 40681064 missense probably benign 0.01
R5787:Adam24 UTSW 8 40680902 missense possibly damaging 0.87
R5900:Adam24 UTSW 8 40681032 missense probably benign 0.00
R6600:Adam24 UTSW 8 40680548 missense probably damaging 1.00
R6633:Adam24 UTSW 8 40680487 missense probably benign 0.12
R6672:Adam24 UTSW 8 40681533 missense probably benign 0.01
R6904:Adam24 UTSW 8 40681503 missense probably damaging 1.00
R7178:Adam24 UTSW 8 40680000 nonsense probably null
R7542:Adam24 UTSW 8 40680809 missense possibly damaging 0.46
R7578:Adam24 UTSW 8 40680255 missense probably benign 0.01
R7708:Adam24 UTSW 8 40680519 missense probably damaging 1.00
X0010:Adam24 UTSW 8 40680015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTATTAACGGTCAGTGCTGC -3'
(R):5'- CTCAAAGAGGACACCTTGGTC -3'

Sequencing Primer
(F):5'- TCAGTGCTGCATGGGATTAAGAC -3'
(R):5'- GACACCTTGGTCATTGTATGTGAAC -3'
Posted On2015-02-19