Incidental Mutation 'R3551:Edc4'
ID268344
Institutional Source Beutler Lab
Gene Symbol Edc4
Ensembl Gene ENSMUSG00000036270
Gene Nameenhancer of mRNA decapping 4
Synonyms
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105880881-105894908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105885494 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 138 (I138F)
Ref Sequence ENSEMBL: ENSMUSP00000114285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040254] [ENSMUST00000119261] [ENSMUST00000136048] [ENSMUST00000145618]
Predicted Effect probably damaging
Transcript: ENSMUST00000040254
AA Change: I138F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039134
Gene: ENSMUSG00000036270
AA Change: I138F

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
coiled coil region 1001 1030 N/A INTRINSIC
low complexity region 1267 1285 N/A INTRINSIC
PDB:2VXG|B 1286 1402 3e-18 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000119261
AA Change: I138F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113854
Gene: ENSMUSG00000036270
AA Change: I138F

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
coiled coil region 985 1014 N/A INTRINSIC
low complexity region 1251 1269 N/A INTRINSIC
PDB:2VXG|B 1270 1386 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000132680
SMART Domains Protein: ENSMUSP00000114209
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
low complexity region 189 224 N/A INTRINSIC
low complexity region 245 273 N/A INTRINSIC
low complexity region 354 366 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136048
AA Change: I138F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114285
Gene: ENSMUSG00000036270
AA Change: I138F

DomainStartEndE-ValueType
Blast:WD40 33 93 9e-8 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
low complexity region 549 584 N/A INTRINSIC
low complexity region 604 632 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
low complexity region 961 990 N/A INTRINSIC
low complexity region 1215 1233 N/A INTRINSIC
PDB:2VXG|B 1234 1317 1e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139154
Predicted Effect probably benign
Transcript: ENSMUST00000145618
SMART Domains Protein: ENSMUSP00000118162
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
low complexity region 185 220 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156357
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is thought to promote mRNA decay, and is known to interact with several mRNA decapping proteins. In humans, decreased expression of this gene prevents the accumulation of mRNA decapping proteins to mRNA processing bodies (P-body). Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Edc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Edc4 APN 8 105881123 missense probably damaging 1.00
IGL01069:Edc4 APN 8 105887134 missense probably benign 0.35
IGL01470:Edc4 APN 8 105889981 unclassified probably benign
IGL01656:Edc4 APN 8 105886377 missense possibly damaging 0.55
IGL01804:Edc4 APN 8 105890657 missense possibly damaging 0.92
IGL02135:Edc4 APN 8 105885822 missense probably damaging 1.00
IGL02825:Edc4 APN 8 105890611 missense probably damaging 1.00
IGL03036:Edc4 APN 8 105887311 unclassified probably null
IGL03401:Edc4 APN 8 105887514 nonsense probably null
IGL03409:Edc4 APN 8 105885116 missense probably damaging 1.00
Armor UTSW 8 105890867 missense probably damaging 1.00
mail UTSW 8 105886309 splice site probably null
R0362:Edc4 UTSW 8 105886775 missense probably damaging 1.00
R0541:Edc4 UTSW 8 105889428 missense probably benign 0.00
R0614:Edc4 UTSW 8 105889396 missense possibly damaging 0.93
R0631:Edc4 UTSW 8 105890792 missense possibly damaging 0.57
R1067:Edc4 UTSW 8 105891005 missense probably damaging 0.97
R1270:Edc4 UTSW 8 105891264 missense possibly damaging 0.90
R1371:Edc4 UTSW 8 105890750 unclassified probably benign
R1384:Edc4 UTSW 8 105892382 missense probably damaging 1.00
R1417:Edc4 UTSW 8 105887855 critical splice donor site probably null
R1423:Edc4 UTSW 8 105891211 unclassified probably benign
R1446:Edc4 UTSW 8 105888132 missense probably damaging 0.96
R1472:Edc4 UTSW 8 105892828 missense probably damaging 0.99
R1797:Edc4 UTSW 8 105891085 missense probably benign 0.03
R2086:Edc4 UTSW 8 105888002 missense probably damaging 1.00
R2092:Edc4 UTSW 8 105887528 missense probably damaging 1.00
R3079:Edc4 UTSW 8 105885118 missense possibly damaging 0.86
R4492:Edc4 UTSW 8 105885068 frame shift probably null
R4650:Edc4 UTSW 8 105892675 nonsense probably null
R4735:Edc4 UTSW 8 105887186 missense probably damaging 1.00
R4854:Edc4 UTSW 8 105887925 intron probably benign
R5530:Edc4 UTSW 8 105889254 nonsense probably null
R5851:Edc4 UTSW 8 105890867 missense probably damaging 1.00
R5889:Edc4 UTSW 8 105888022 missense possibly damaging 0.87
R5903:Edc4 UTSW 8 105890587 missense probably benign 0.04
R5996:Edc4 UTSW 8 105887401 missense probably damaging 1.00
R6078:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6079:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6143:Edc4 UTSW 8 105885874 missense probably damaging 1.00
R7072:Edc4 UTSW 8 105888002 missense probably damaging 1.00
R7211:Edc4 UTSW 8 105886309 splice site probably null
R7368:Edc4 UTSW 8 105888405 small deletion probably benign
R7429:Edc4 UTSW 8 105891584 missense probably damaging 1.00
R7430:Edc4 UTSW 8 105891584 missense probably damaging 1.00
R7787:Edc4 UTSW 8 105887514 nonsense probably null
RF009:Edc4 UTSW 8 105889180 missense probably benign 0.27
RF014:Edc4 UTSW 8 105884600 missense probably benign
U15987:Edc4 UTSW 8 105887548 missense probably benign 0.01
X0018:Edc4 UTSW 8 105887001 missense probably damaging 1.00
X0063:Edc4 UTSW 8 105884580 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTCCCAAACCTCTGTGGAAATC -3'
(R):5'- AGAGGATTGTGAGCCAGCAC -3'

Sequencing Primer
(F):5'- ACCTCTGTGGAAATCTGATCTAGGAG -3'
(R):5'- ACAGCGCCTACCGAGTCTG -3'
Posted On2015-02-19