Incidental Mutation 'R3551:Ect2l'
ID268346
Institutional Source Beutler Lab
Gene Symbol Ect2l
Ensembl Gene ENSMUSG00000071392
Gene Nameepithelial cell transforming sequence 2 oncogene-like
SynonymsC330021H03Rik, Gm10331
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location18128903-18210890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18163393 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 339 (I339T)
Ref Sequence ENSEMBL: ENSMUSP00000147170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095817] [ENSMUST00000207827] [ENSMUST00000208948] [ENSMUST00000209178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095817
AA Change: I431T

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093497
Gene: ENSMUSG00000071392
AA Change: I431T

DomainStartEndE-ValueType
FBOX 93 133 3.5e-4 SMART
Pfam:DUF4347 297 468 1.4e-11 PFAM
RhoGEF 578 761 6.3e-46 SMART
Blast:PH 793 909 6e-49 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000207827
AA Change: I431T

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208948
AA Change: I431T

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000209178
AA Change: I339T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Ect2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Ect2l APN 10 18130730 missense probably damaging 1.00
IGL01773:Ect2l APN 10 18161504 missense probably damaging 0.97
IGL02293:Ect2l APN 10 18140511 critical splice donor site probably null
IGL02589:Ect2l APN 10 18140594 splice site probably benign
IGL02866:Ect2l APN 10 18159817 missense probably damaging 1.00
R0037:Ect2l UTSW 10 18143097 missense probably damaging 1.00
R0526:Ect2l UTSW 10 18199940 missense possibly damaging 0.92
R0628:Ect2l UTSW 10 18143040 missense probably damaging 1.00
R0839:Ect2l UTSW 10 18141904 missense probably benign 0.03
R0948:Ect2l UTSW 10 18140586 missense probably damaging 1.00
R1103:Ect2l UTSW 10 18140526 missense probably damaging 1.00
R1238:Ect2l UTSW 10 18143104 missense possibly damaging 0.94
R1326:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1327:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1544:Ect2l UTSW 10 18168434 missense probably benign 0.04
R1848:Ect2l UTSW 10 18200033 missense probably damaging 1.00
R1921:Ect2l UTSW 10 18143004 missense possibly damaging 0.89
R1938:Ect2l UTSW 10 18144635 missense probably benign 0.00
R2081:Ect2l UTSW 10 18165527 missense probably damaging 1.00
R3608:Ect2l UTSW 10 18142940 missense possibly damaging 0.92
R3886:Ect2l UTSW 10 18168458 missense probably damaging 1.00
R4120:Ect2l UTSW 10 18130718 missense probably benign 0.00
R4348:Ect2l UTSW 10 18136988 missense probably damaging 1.00
R4992:Ect2l UTSW 10 18172729 missense probably benign 0.00
R5053:Ect2l UTSW 10 18140345 missense probably damaging 1.00
R5144:Ect2l UTSW 10 18144577 missense probably benign 0.03
R5654:Ect2l UTSW 10 18143062 missense probably damaging 0.99
R5779:Ect2l UTSW 10 18163438 missense probably benign 0.09
R5814:Ect2l UTSW 10 18200009 missense probably damaging 0.97
R6053:Ect2l UTSW 10 18141844 missense probably damaging 1.00
R6057:Ect2l UTSW 10 18161502 missense probably benign 0.02
R6244:Ect2l UTSW 10 18140397 missense possibly damaging 0.93
R6720:Ect2l UTSW 10 18140264 missense probably damaging 1.00
R6817:Ect2l UTSW 10 18174059 missense probably benign 0.00
R6894:Ect2l UTSW 10 18169380 critical splice donor site probably null
R7199:Ect2l UTSW 10 18129146 missense probably benign 0.02
R7313:Ect2l UTSW 10 18168401 missense probably damaging 0.98
R7404:Ect2l UTSW 10 18159781 missense probably damaging 0.99
R7482:Ect2l UTSW 10 18168454 missense probably benign 0.07
R7751:Ect2l UTSW 10 18169405 missense possibly damaging 0.82
R7752:Ect2l UTSW 10 18141964 missense possibly damaging 0.94
R7880:Ect2l UTSW 10 18136954 missense possibly damaging 0.60
R7901:Ect2l UTSW 10 18141964 missense possibly damaging 0.94
R7963:Ect2l UTSW 10 18136954 missense possibly damaging 0.60
R7984:Ect2l UTSW 10 18141964 missense possibly damaging 0.94
R8138:Ect2l UTSW 10 18169405 missense probably damaging 0.96
X0018:Ect2l UTSW 10 18130652 missense probably benign 0.02
Z1177:Ect2l UTSW 10 18172672 missense probably null 0.71
Predicted Primers PCR Primer
(F):5'- CAGGAGAGACGTATATCAGCAC -3'
(R):5'- TGACTGCCTCAGGAGAAACC -3'

Sequencing Primer
(F):5'- CTGATGAACAGCTGCTAGTTACTGAG -3'
(R):5'- CAGGAGAAACCCAAGGATTATTTTCC -3'
Posted On2015-02-19