Incidental Mutation 'R3551:Gm4922'
ID268347
Institutional Source Beutler Lab
Gene Symbol Gm4922
Ensembl Gene ENSMUSG00000044624
Gene Namepredicted gene 4922
Synonyms
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location18779725-18786793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18784496 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 159 (N159K)
Ref Sequence ENSEMBL: ENSMUSP00000149756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055107] [ENSMUST00000216654]
Predicted Effect probably benign
Transcript: ENSMUST00000055107
AA Change: N159K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000055273
Gene: ENSMUSG00000044624
AA Change: N159K

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
S_TKc 28 275 1.92e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215162
Predicted Effect probably benign
Transcript: ENSMUST00000216654
AA Change: N159K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Gm4922
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Gm4922 APN 10 18784047 missense probably benign 0.20
IGL01818:Gm4922 APN 10 18784953 missense unknown
IGL01931:Gm4922 APN 10 18784294 missense probably benign 0.01
IGL02021:Gm4922 APN 10 18784477 missense probably damaging 1.00
IGL02573:Gm4922 APN 10 18783675 missense probably benign 0.05
IGL03305:Gm4922 APN 10 18783484 nonsense probably null
R0149:Gm4922 UTSW 10 18783541 missense probably benign 0.10
R0361:Gm4922 UTSW 10 18783541 missense probably benign 0.10
R0564:Gm4922 UTSW 10 18784065 missense possibly damaging 0.66
R1079:Gm4922 UTSW 10 18784338 missense probably damaging 0.97
R1163:Gm4922 UTSW 10 18783721 missense possibly damaging 0.83
R1164:Gm4922 UTSW 10 18783721 missense possibly damaging 0.83
R1398:Gm4922 UTSW 10 18783748 missense possibly damaging 0.65
R1458:Gm4922 UTSW 10 18783892 nonsense probably null
R1867:Gm4922 UTSW 10 18784463 missense possibly damaging 0.73
R1994:Gm4922 UTSW 10 18783640 missense probably benign 0.10
R2146:Gm4922 UTSW 10 18783516 missense probably benign
R2437:Gm4922 UTSW 10 18784081 missense probably benign 0.00
R3939:Gm4922 UTSW 10 18784614 missense probably damaging 1.00
R4580:Gm4922 UTSW 10 18783684 missense probably benign 0.00
R4602:Gm4922 UTSW 10 18784259 nonsense probably null
R4704:Gm4922 UTSW 10 18784819 missense probably benign 0.20
R4790:Gm4922 UTSW 10 18784168 missense possibly damaging 0.58
R5478:Gm4922 UTSW 10 18784137 missense probably benign
R5510:Gm4922 UTSW 10 18783997 missense probably benign 0.00
R5694:Gm4922 UTSW 10 18784287 missense possibly damaging 0.76
R6080:Gm4922 UTSW 10 18784752 missense probably damaging 1.00
R6869:Gm4922 UTSW 10 18784515 missense probably damaging 1.00
R6923:Gm4922 UTSW 10 18783868 missense probably damaging 1.00
R7667:Gm4922 UTSW 10 18784348 missense probably damaging 1.00
R8198:Gm4922 UTSW 10 18783592 missense probably benign 0.00
R8270:Gm4922 UTSW 10 18784012 missense probably benign 0.00
R8310:Gm4922 UTSW 10 18783788 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTGCTAATTTCTGACAAGGTGG -3'
(R):5'- TGATTATGGAAGTGGCCCAAG -3'

Sequencing Primer
(F):5'- ATTTCTGACAAGGTGGACCCTAC -3'
(R):5'- GGCACACAGCTACATAATCGAGTC -3'
Posted On2015-02-19