Incidental Mutation 'R3551:Gm5134'
ID268348
Institutional Source Beutler Lab
Gene Symbol Gm5134
Ensembl Gene ENSMUSG00000033255
Gene Namepredicted gene 5134
Synonyms
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75954514-76009591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 76000447 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 421 (A421S)
Ref Sequence ENSEMBL: ENSMUSP00000097172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099577]
Predicted Effect probably benign
Transcript: ENSMUST00000099577
AA Change: A421S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097172
Gene: ENSMUSG00000033255
AA Change: A421S

DomainStartEndE-ValueType
Pfam:SSF 32 466 2.9e-119 PFAM
transmembrane domain 500 522 N/A INTRINSIC
transmembrane domain 651 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134234
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Gm5134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Gm5134 APN 10 76000421 missense possibly damaging 0.70
IGL01371:Gm5134 APN 10 76004747 missense probably damaging 0.99
IGL02140:Gm5134 APN 10 75986111 missense probably benign 0.03
IGL02197:Gm5134 APN 10 75954702 critical splice donor site probably null
IGL02233:Gm5134 APN 10 76008500 critical splice acceptor site probably null
IGL02612:Gm5134 APN 10 75992489 missense probably damaging 1.00
IGL02896:Gm5134 APN 10 75974224 missense possibly damaging 0.82
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0110:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R0499:Gm5134 UTSW 10 75992525 missense probably benign 0.00
R0510:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R1429:Gm5134 UTSW 10 75978381 missense probably damaging 1.00
R1726:Gm5134 UTSW 10 75992527 missense possibly damaging 0.83
R1918:Gm5134 UTSW 10 75976346 missense possibly damaging 0.70
R1956:Gm5134 UTSW 10 76004846 missense possibly damaging 0.89
R1993:Gm5134 UTSW 10 75966393 missense probably damaging 0.96
R2049:Gm5134 UTSW 10 76004884 missense possibly damaging 0.92
R2188:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R4074:Gm5134 UTSW 10 76008531 missense probably damaging 1.00
R4435:Gm5134 UTSW 10 75995824 missense probably damaging 1.00
R4466:Gm5134 UTSW 10 76008575 missense probably benign 0.00
R5180:Gm5134 UTSW 10 75976366 missense probably damaging 1.00
R5446:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R5601:Gm5134 UTSW 10 75985952 missense probably damaging 0.98
R5627:Gm5134 UTSW 10 75986108 missense possibly damaging 0.93
R5777:Gm5134 UTSW 10 76004760 missense probably benign 0.00
R5867:Gm5134 UTSW 10 76008616 missense probably benign 0.00
R6145:Gm5134 UTSW 10 75995839 missense probably damaging 0.99
R6232:Gm5134 UTSW 10 75986025 missense possibly damaging 0.95
R6271:Gm5134 UTSW 10 75995809 missense probably benign 0.32
R6329:Gm5134 UTSW 10 75954660 missense possibly damaging 0.68
R6723:Gm5134 UTSW 10 76008619 missense probably benign
R7049:Gm5134 UTSW 10 75992458 missense probably damaging 0.97
R7305:Gm5134 UTSW 10 76000399 missense probably damaging 1.00
R7579:Gm5134 UTSW 10 75964437 missense probably damaging 1.00
X0050:Gm5134 UTSW 10 75992510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTCAGAACTACAACAGTAGTAG -3'
(R):5'- GTGAACTCCTGATACACAAGAGAC -3'

Sequencing Primer
(F):5'- CATCACTGAGTGTTGGCTT -3'
(R):5'- CATCGCTAAGGCCGATCTTGTAAAG -3'
Posted On2015-02-19