Incidental Mutation 'R3551:Zfp692'
ID268352
Institutional Source Beutler Lab
Gene Symbol Zfp692
Ensembl Gene ENSMUSG00000037243
Gene Namezinc finger protein 692
SynonymsZfp692-ps
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58307069-58314627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58309428 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 170 (T170I)
Ref Sequence ENSEMBL: ENSMUSP00000131896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049353] [ENSMUST00000153510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049353
AA Change: T170I

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131896
Gene: ENSMUSG00000037243
AA Change: T170I

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153510
AA Change: T170I

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126674
Gene: ENSMUSG00000037243
AA Change: T170I

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
low complexity region 159 175 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
ZnF_C2H2 327 352 4.11e-2 SMART
ZnF_C2H2 358 382 2.05e-2 SMART
ZnF_C2H2 388 410 1.69e-3 SMART
ZnF_C2H2 416 438 1.69e-3 SMART
ZnF_C2H2 447 470 6.23e-2 SMART
low complexity region 502 520 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Zfp692
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Zfp692 APN 11 58314029 missense possibly damaging 0.94
IGL00978:Zfp692 APN 11 58309998 missense possibly damaging 0.92
IGL01667:Zfp692 APN 11 58311553 missense probably damaging 1.00
IGL02209:Zfp692 APN 11 58313998 nonsense probably null
IGL02873:Zfp692 APN 11 58308939 missense probably damaging 1.00
R0255:Zfp692 UTSW 11 58310403 splice site probably benign
R0267:Zfp692 UTSW 11 58314314 missense possibly damaging 0.64
R0506:Zfp692 UTSW 11 58309055 nonsense probably null
R0554:Zfp692 UTSW 11 58314227 missense probably damaging 1.00
R0628:Zfp692 UTSW 11 58309623 missense probably damaging 1.00
R0712:Zfp692 UTSW 11 58314314 missense probably benign 0.00
R1112:Zfp692 UTSW 11 58311562 missense probably damaging 1.00
R1493:Zfp692 UTSW 11 58314040 missense probably damaging 1.00
R1768:Zfp692 UTSW 11 58310176 splice site probably benign
R1853:Zfp692 UTSW 11 58309979 missense possibly damaging 0.69
R3552:Zfp692 UTSW 11 58309428 missense possibly damaging 0.52
R4281:Zfp692 UTSW 11 58314265 missense probably damaging 1.00
R4784:Zfp692 UTSW 11 58310171 missense probably null 0.12
R5150:Zfp692 UTSW 11 58307587 start codon destroyed probably null 0.77
R7035:Zfp692 UTSW 11 58309442 critical splice donor site probably null
R7343:Zfp692 UTSW 11 58311505 missense probably damaging 1.00
R7896:Zfp692 UTSW 11 58314236 missense probably damaging 1.00
R7979:Zfp692 UTSW 11 58314236 missense probably damaging 1.00
R8071:Zfp692 UTSW 11 58307734 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCATTGCTAGGTATGGGAAGC -3'
(R):5'- AATCCCAACTGGCTCATCTG -3'

Sequencing Primer
(F):5'- CTAGGTATGGGAAGCAAAAGTGTG -3'
(R):5'- AACTGGCTCATCTGGGGAG -3'
Posted On2015-02-19