Incidental Mutation 'R3551:Olfr378'
ID268354
Institutional Source Beutler Lab
Gene Symbol Olfr378
Ensembl Gene ENSMUSG00000055971
Gene Nameolfactory receptor 378
SynonymsMOR135-2, GA_x6K02T2P1NL-3586282-3585338
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73424609-73428477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73425852 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 44 (I44V)
Ref Sequence ENSEMBL: ENSMUSP00000066971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069790] [ENSMUST00000117349]
Predicted Effect probably benign
Transcript: ENSMUST00000069790
AA Change: I44V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000066971
Gene: ENSMUSG00000055971
AA Change: I44V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 297 7.9e-6 PFAM
Pfam:7tm_1 41 290 3.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117349
AA Change: I44V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113524
Gene: ENSMUSG00000084387
AA Change: I44V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 297 7.9e-6 PFAM
Pfam:7tm_1 41 290 3.3e-34 PFAM
Pfam:7tm_4 139 283 2.8e-40 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Olfr378
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01996:Olfr378 APN 11 73425968 missense probably damaging 1.00
IGL02427:Olfr378 APN 11 73425661 missense probably damaging 1.00
IGL03089:Olfr378 APN 11 73425183 missense probably benign
R0443:Olfr378 UTSW 11 73425755 missense probably damaging 1.00
R1497:Olfr378 UTSW 11 73425827 missense possibly damaging 0.88
R2005:Olfr378 UTSW 11 73425239 missense probably damaging 1.00
R2029:Olfr378 UTSW 11 73425362 missense probably benign 0.00
R2140:Olfr378 UTSW 11 73425881 missense probably damaging 0.98
R3552:Olfr378 UTSW 11 73425852 missense probably benign 0.00
R4433:Olfr378 UTSW 11 73425711 missense possibly damaging 0.50
R4546:Olfr378 UTSW 11 73425186 missense probably benign 0.23
R4686:Olfr378 UTSW 11 73425438 missense probably benign 0.35
R5168:Olfr378 UTSW 11 73425843 missense probably benign 0.01
R5567:Olfr378 UTSW 11 73425446 missense probably damaging 1.00
R5755:Olfr378 UTSW 11 73425731 missense probably benign 0.22
R7190:Olfr378 UTSW 11 73425164 missense probably benign 0.07
R7287:Olfr378 UTSW 11 73425843 missense probably benign 0.01
R7404:Olfr378 UTSW 11 73425593 missense probably damaging 1.00
R7462:Olfr378 UTSW 11 73425470 missense probably benign 0.06
R7544:Olfr378 UTSW 11 73425770 missense probably damaging 1.00
R7702:Olfr378 UTSW 11 73433349 unclassified probably benign
X0010:Olfr378 UTSW 11 73425151 missense possibly damaging 0.59
Z1088:Olfr378 UTSW 11 73425105 unclassified probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATAGCGGTCATAGGCCATG -3'
(R):5'- ATTGGGAATGTTAACTGCTGC -3'

Sequencing Primer
(F):5'- AAGAAGTATATTTGTGCCAGGCAACC -3'
(R):5'- GAAGAAACCAAACTGTCATC -3'
Posted On2015-02-19