Incidental Mutation 'R3551:Acaca'
ID268355
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Nameacetyl-Coenzyme A carboxylase alpha
SynonymsLOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84129672-84401651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84261624 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 866 (Y866N)
Ref Sequence ENSEMBL: ENSMUSP00000099490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: Y866N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: Y866N

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: Y866N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: Y866N

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Meta Mutation Damage Score 0.8971 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
greenhouse UTSW 11 84338356 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 unclassified probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
R7664:Acaca UTSW 11 84245349 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7898:Acaca UTSW 11 84364449 critical splice donor site probably null
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7950:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7981:Acaca UTSW 11 84364449 critical splice donor site probably null
R7990:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCATGAAGGGATGTCTCAG -3'
(R):5'- GCTTACTGTAAAGCTGCAGCC -3'

Sequencing Primer
(F):5'- CATGAAGGGATGTCTCAGTTTTG -3'
(R):5'- CTCAGTGGTGCAGTGATCACATAG -3'
Posted On2015-02-19