Incidental Mutation 'R3551:Ercc6l2'
ID268357
Institutional Source Beutler Lab
Gene Symbol Ercc6l2
Ensembl Gene ENSMUSG00000021470
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms0610007P08Rik, 1700019D06Rik, 9330134C04Rik
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location63815240-63900302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63844595 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 401 (V401E)
Ref Sequence ENSEMBL: ENSMUSP00000069488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021925] [ENSMUST00000021926] [ENSMUST00000067821] [ENSMUST00000095724] [ENSMUST00000142827] [ENSMUST00000159957]
Predicted Effect probably damaging
Transcript: ENSMUST00000021925
AA Change: V401E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021925
Gene: ENSMUSG00000021470
AA Change: V401E

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 2e-13 BLAST
HELICc 512 589 6.96e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000021926
AA Change: V286E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021926
Gene: ENSMUSG00000021470
AA Change: V286E

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
DEXDc 28 216 1.74e-12 SMART
Blast:DEXDc 265 310 1e-13 BLAST
Blast:DEXDc 317 450 4e-30 BLAST
SCOP:d1hv8a2 388 466 7e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067821
AA Change: V401E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069488
Gene: ENSMUSG00000021470
AA Change: V401E

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 3e-13 BLAST
HELICc 536 619 3.12e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095724
SMART Domains Protein: ENSMUSP00000093392
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
DEXDc 1 183 2.72e-14 SMART
Blast:DEXDc 232 277 3e-13 BLAST
HELICc 388 471 3.12e-23 SMART
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142827
SMART Domains Protein: ENSMUSP00000115796
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
Pfam:DEAD 1 144 5.4e-6 PFAM
Pfam:SNF2_N 3 144 1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143449
AA Change: V401E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123573
Gene: ENSMUSG00000021470
AA Change: V401E

DomainStartEndE-ValueType
DEXDc 118 331 1.94e-33 SMART
Blast:DEXDc 380 425 2e-13 BLAST
Blast:DEXDc 432 565 2e-29 BLAST
SCOP:d1hv8a2 503 581 2e-8 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000159957
SMART Domains Protein: ENSMUSP00000124912
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
Pfam:SNF2_N 101 195 2.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222855
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Ercc6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Ercc6l2 APN 13 63858319 missense probably damaging 0.99
IGL00678:Ercc6l2 APN 13 63844613 missense probably damaging 1.00
IGL00765:Ercc6l2 APN 13 63848772 missense possibly damaging 0.95
IGL01062:Ercc6l2 APN 13 63847454 missense probably null 1.00
IGL01655:Ercc6l2 APN 13 63819752 nonsense probably null
IGL02175:Ercc6l2 APN 13 63869190 utr 3 prime probably benign
IGL02201:Ercc6l2 APN 13 63852969 missense probably benign 0.12
IGL02351:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02358:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02622:Ercc6l2 APN 13 63853623 unclassified probably null
PIT4812001:Ercc6l2 UTSW 13 63858257 missense possibly damaging 0.58
R0142:Ercc6l2 UTSW 13 63872506 unclassified probably benign
R0648:Ercc6l2 UTSW 13 63844645 missense probably benign 0.04
R1136:Ercc6l2 UTSW 13 63869120 missense possibly damaging 0.75
R1536:Ercc6l2 UTSW 13 63824871 missense possibly damaging 0.81
R1706:Ercc6l2 UTSW 13 63872458 unclassified probably benign
R2108:Ercc6l2 UTSW 13 63871988 unclassified probably benign
R2111:Ercc6l2 UTSW 13 63834749 missense probably damaging 1.00
R2126:Ercc6l2 UTSW 13 63848771 missense probably damaging 1.00
R2154:Ercc6l2 UTSW 13 63866007 missense probably damaging 1.00
R3773:Ercc6l2 UTSW 13 63841450 missense probably damaging 1.00
R3923:Ercc6l2 UTSW 13 63870735 unclassified probably benign
R4233:Ercc6l2 UTSW 13 63872168 unclassified probably benign
R4782:Ercc6l2 UTSW 13 63834738 missense probably damaging 1.00
R4928:Ercc6l2 UTSW 13 63894813 utr 3 prime probably benign
R5163:Ercc6l2 UTSW 13 63899031 utr 3 prime probably benign
R5268:Ercc6l2 UTSW 13 63869111 missense possibly damaging 0.92
R5423:Ercc6l2 UTSW 13 63872258 unclassified probably benign
R6128:Ercc6l2 UTSW 13 63853749 missense probably damaging 0.98
R6164:Ercc6l2 UTSW 13 63872344 unclassified probably benign
R7238:Ercc6l2 UTSW 13 63865984 missense probably damaging 0.98
R7295:Ercc6l2 UTSW 13 63819775 missense probably damaging 0.96
R7708:Ercc6l2 UTSW 13 63841514 nonsense probably null
R8085:Ercc6l2 UTSW 13 63844553 missense probably benign 0.00
R8131:Ercc6l2 UTSW 13 63834747 missense probably damaging 1.00
R8259:Ercc6l2 UTSW 13 63872471 missense
RF013:Ercc6l2 UTSW 13 63853017 missense probably benign 0.06
Z1088:Ercc6l2 UTSW 13 63853728 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCATAGAGACATAAGCAGAGGT -3'
(R):5'- GGGCTCTAGGGATCAGAACT -3'

Sequencing Primer
(F):5'- AGGTAGTGTGGGTGATAGCAC -3'
(R):5'- CTCTAGGGATCAGAACTAAGCTGTC -3'
Posted On2015-02-19