Incidental Mutation 'R3551:Zfp759'
ID268358
Institutional Source Beutler Lab
Gene Symbol Zfp759
Ensembl Gene ENSMUSG00000057396
Gene Namezinc finger protein 759
SynonymsRslcan-8
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67121660-67141787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67138967 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 194 (V194A)
Ref Sequence ENSEMBL: ENSMUSP00000049650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052716] [ENSMUST00000224346]
Predicted Effect probably benign
Transcript: ENSMUST00000052716
AA Change: V194A

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049650
Gene: ENSMUSG00000057396
AA Change: V194A

DomainStartEndE-ValueType
KRAB 5 65 1.6e-22 SMART
ZnF_C2H2 106 128 5.54e1 SMART
ZnF_C2H2 162 184 3.83e-2 SMART
ZnF_C2H2 190 212 1.82e-3 SMART
ZnF_C2H2 218 240 1.64e-1 SMART
ZnF_C2H2 246 268 1.67e-2 SMART
ZnF_C2H2 274 296 1.95e-3 SMART
ZnF_C2H2 302 324 1.84e-4 SMART
ZnF_C2H2 330 352 7.78e-3 SMART
ZnF_C2H2 358 380 1.6e-4 SMART
ZnF_C2H2 386 408 1.67e-2 SMART
ZnF_C2H2 414 436 4.87e-4 SMART
ZnF_C2H2 442 464 3.39e-3 SMART
ZnF_C2H2 498 520 2.57e-3 SMART
ZnF_C2H2 526 548 8.47e-4 SMART
ZnF_C2H2 554 576 2.02e-1 SMART
ZnF_C2H2 582 604 2.53e-2 SMART
ZnF_C2H2 610 632 4.79e-3 SMART
ZnF_C2H2 638 660 1.84e-4 SMART
ZnF_C2H2 666 688 1.36e-2 SMART
ZnF_C2H2 694 716 4.17e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223605
Predicted Effect probably benign
Transcript: ENSMUST00000224346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224426
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Other mutations in Zfp759
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Zfp759 APN 13 67139594 missense probably benign 0.25
IGL03131:Zfp759 APN 13 67138664 missense probably damaging 1.00
IGL03218:Zfp759 APN 13 67139416 missense probably benign 0.00
R0243:Zfp759 UTSW 13 67138813 missense possibly damaging 0.66
R0319:Zfp759 UTSW 13 67140292 missense probably benign 0.00
R0520:Zfp759 UTSW 13 67137355 missense probably benign 0.29
R0961:Zfp759 UTSW 13 67139863 missense probably benign 0.32
R1435:Zfp759 UTSW 13 67138766 missense possibly damaging 0.73
R1649:Zfp759 UTSW 13 67139604 missense probably benign 0.00
R1880:Zfp759 UTSW 13 67139212 missense probably damaging 1.00
R2118:Zfp759 UTSW 13 67139514 unclassified probably benign
R2170:Zfp759 UTSW 13 67136748 missense possibly damaging 0.88
R3154:Zfp759 UTSW 13 67138655 missense probably benign 0.20
R4392:Zfp759 UTSW 13 67139643 nonsense probably null
R4495:Zfp759 UTSW 13 67138925 unclassified probably null
R4736:Zfp759 UTSW 13 67139344 missense probably damaging 1.00
R4882:Zfp759 UTSW 13 67139290 missense probably damaging 1.00
R5717:Zfp759 UTSW 13 67138708 missense probably damaging 1.00
R5921:Zfp759 UTSW 13 67140494 missense probably damaging 1.00
R6247:Zfp759 UTSW 13 67140460 missense probably benign 0.00
R6381:Zfp759 UTSW 13 67138905 nonsense probably null
R6427:Zfp759 UTSW 13 67139098 unclassified probably null
R6567:Zfp759 UTSW 13 67139086 missense probably benign 0.34
R7140:Zfp759 UTSW 13 67140113 missense possibly damaging 0.92
R7731:Zfp759 UTSW 13 67139626 missense possibly damaging 0.82
Z1176:Zfp759 UTSW 13 67136808 missense probably damaging 0.98
Z1177:Zfp759 UTSW 13 67140148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTTGGCAAGTCCTTTTG -3'
(R):5'- TGGAGAGTGGAAGGCCTT -3'

Sequencing Primer
(F):5'- TACAAGTATGAAACATGTAGCAAGGC -3'
(R):5'- GCCACATACTTCACACTTGTAGGG -3'
Posted On2015-02-19