Incidental Mutation 'R3551:Kng2'
ID268363
Institutional Source Beutler Lab
Gene Symbol Kng2
Ensembl Gene ENSMUSG00000060459
Gene Namekininogen 2
SynonymsKininogen-II
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22985854-23029482 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 23011995 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039338] [ENSMUST00000100046] [ENSMUST00000115349] [ENSMUST00000160243] [ENSMUST00000231835] [ENSMUST00000232459]
Predicted Effect probably null
Transcript: ENSMUST00000039338
SMART Domains Protein: ENSMUSP00000046867
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100046
SMART Domains Protein: ENSMUSP00000097623
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115349
SMART Domains Protein: ENSMUSP00000111006
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
CY 140 248 2.57e-22 SMART
CY 262 370 2.06e-35 SMART
low complexity region 376 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159889
Predicted Effect probably benign
Transcript: ENSMUST00000160243
SMART Domains Protein: ENSMUSP00000124161
Gene: ENSMUSG00000060459

DomainStartEndE-ValueType
CY 18 126 3.72e-19 SMART
Blast:CY 140 171 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231835
Predicted Effect probably null
Transcript: ENSMUST00000232459
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Kng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Kng2 APN 16 23028830 missense probably damaging 1.00
IGL01319:Kng2 APN 16 23028834 missense probably damaging 0.99
IGL01469:Kng2 APN 16 22999827 missense probably damaging 1.00
IGL01681:Kng2 APN 16 22997017 splice site probably benign
IGL01830:Kng2 APN 16 22988051 missense probably damaging 0.97
IGL01903:Kng2 APN 16 22987790 missense possibly damaging 0.80
IGL02146:Kng2 APN 16 22987832 missense probably damaging 0.97
IGL02305:Kng2 APN 16 23000624 unclassified probably benign
IGL02429:Kng2 APN 16 23012079 missense probably damaging 0.99
FR4548:Kng2 UTSW 16 23000552 nonsense probably null
R0020:Kng2 UTSW 16 22997296 missense probably benign 0.02
R0047:Kng2 UTSW 16 22987563 missense possibly damaging 0.83
R0245:Kng2 UTSW 16 23012181 splice site probably benign
R0610:Kng2 UTSW 16 23000594 missense possibly damaging 0.96
R0646:Kng2 UTSW 16 22987736 missense probably benign 0.10
R0666:Kng2 UTSW 16 22997122 splice site probably benign
R1552:Kng2 UTSW 16 22987520 missense probably damaging 1.00
R1765:Kng2 UTSW 16 22988243 critical splice donor site probably null
R1833:Kng2 UTSW 16 23012052 missense possibly damaging 0.95
R1997:Kng2 UTSW 16 23024876 missense possibly damaging 0.84
R2025:Kng2 UTSW 16 23000575 missense probably benign 0.15
R2056:Kng2 UTSW 16 22987953 intron probably benign
R2137:Kng2 UTSW 16 22997326 intron probably benign
R2517:Kng2 UTSW 16 22988315 missense probably benign 0.24
R3438:Kng2 UTSW 16 23012071 missense probably benign 0.23
R3439:Kng2 UTSW 16 23012071 missense probably benign 0.23
R4389:Kng2 UTSW 16 23024868 missense possibly damaging 0.91
R4538:Kng2 UTSW 16 22988063 missense probably benign 0.00
R4684:Kng2 UTSW 16 22987641 missense possibly damaging 0.93
R4978:Kng2 UTSW 16 22987916 missense probably damaging 1.00
R5658:Kng2 UTSW 16 22997020 splice site probably null
R6074:Kng2 UTSW 16 23000596 missense probably benign 0.03
R6216:Kng2 UTSW 16 22987593 missense probably damaging 1.00
R6271:Kng2 UTSW 16 23003948 missense probably benign 0.33
R6459:Kng2 UTSW 16 23012115 missense probably damaging 1.00
R7124:Kng2 UTSW 16 23012055 missense probably damaging 1.00
R7310:Kng2 UTSW 16 22987772 missense probably benign 0.00
R7532:Kng2 UTSW 16 23027044 splice site probably null
R7667:Kng2 UTSW 16 22988232 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAACCATGCACTGCGGAG -3'
(R):5'- TAAGGGCCCCATAGTGACAG -3'

Sequencing Primer
(F):5'- TGCATTGCACAACTCACCTGG -3'
(R):5'- CAGAGGAGTACCACTGTGC -3'
Posted On2015-02-19