Incidental Mutation 'R3551:Spice1'
ID268364
Institutional Source Beutler Lab
Gene Symbol Spice1
Ensembl Gene ENSMUSG00000043065
Gene Namespindle and centriole associated protein 1
SynonymsCcdc52, D16Ertd480e
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44347121-44388497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44357869 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 85 (S85I)
Ref Sequence ENSEMBL: ENSMUSP00000058832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050897]
Predicted Effect probably damaging
Transcript: ENSMUST00000050897
AA Change: S85I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058832
Gene: ENSMUSG00000043065
AA Change: S85I

DomainStartEndE-ValueType
Pfam:SPICE 33 436 1.4e-151 PFAM
low complexity region 627 642 N/A INTRINSIC
coiled coil region 729 757 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 804 824 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155661
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Spice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Spice1 APN 16 44366630 missense probably benign 0.20
IGL01688:Spice1 APN 16 44384710 missense probably benign 0.04
IGL03259:Spice1 APN 16 44356167 missense probably damaging 1.00
IGL03367:Spice1 APN 16 44356178 missense probably damaging 0.99
R0230:Spice1 UTSW 16 44365576 splice site probably benign
R0944:Spice1 UTSW 16 44384761 missense probably benign
R1352:Spice1 UTSW 16 44386822 missense probably damaging 1.00
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1894:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1907:Spice1 UTSW 16 44357830 nonsense probably null
R2404:Spice1 UTSW 16 44366626 missense probably benign 0.29
R2444:Spice1 UTSW 16 44366568 nonsense probably null
R3848:Spice1 UTSW 16 44378891 nonsense probably null
R3857:Spice1 UTSW 16 44355443 missense probably damaging 1.00
R4490:Spice1 UTSW 16 44382113 missense probably damaging 1.00
R5593:Spice1 UTSW 16 44370752 missense possibly damaging 0.50
R5996:Spice1 UTSW 16 44384674 missense probably benign 0.00
R6303:Spice1 UTSW 16 44370697 missense probably benign 0.03
R6552:Spice1 UTSW 16 44379033 missense possibly damaging 0.75
R7042:Spice1 UTSW 16 44385680 missense probably benign 0.04
R7062:Spice1 UTSW 16 44357896 missense probably damaging 1.00
R7065:Spice1 UTSW 16 44355535 missense probably damaging 1.00
R7115:Spice1 UTSW 16 44379275 missense probably benign 0.00
R7762:Spice1 UTSW 16 44370501 intron probably null
Predicted Primers PCR Primer
(F):5'- TGGTCTTGCATAGCAGCAGG -3'
(R):5'- AAGCCTACAGAGTTGATGAGTTGTG -3'

Sequencing Primer
(F):5'- CAGCAGGCAATGTCTTTGTTAC -3'
(R):5'- GTTGTGGAAAGTACATTTAAAGCAGC -3'
Posted On2015-02-19