Incidental Mutation 'R3614:Stxbp2'
ID 268374
Institutional Source Beutler Lab
Gene Symbol Stxbp2
Ensembl Gene ENSMUSG00000004626
Gene Name syntaxin binding protein 2
Synonyms muSec1, C79054, Sxtp2, Munc18b, Munc-18b, Munc-18-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3614 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 3680955-3693644 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3681196 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 10 (V10E)
Ref Sequence ENSEMBL: ENSMUSP00000147220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159888] [ENSMUST00000159911] [ENSMUST00000160708] [ENSMUST00000162867]
AlphaFold Q64324
Predicted Effect probably benign
Transcript: ENSMUST00000004745
AA Change: V9E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000004745
Gene: ENSMUSG00000004626
AA Change: V9E

DomainStartEndE-ValueType
Pfam:Sec1 29 580 6.8e-113 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159888
AA Change: V10E
Predicted Effect possibly damaging
Transcript: ENSMUST00000159911
AA Change: V10E

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000160708
AA Change: V10E

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125405
Gene: ENSMUSG00000004626
AA Change: V10E

DomainStartEndE-ValueType
Pfam:Sec1 29 579 4.9e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162737
Predicted Effect unknown
Transcript: ENSMUST00000162867
AA Change: V10E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162974
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality. Mice heterozygous for this allele exhibit decreased stimulated mucin secretion, release of histones in stimulated mast cells and decreased susceptibility to type I hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,403,296 (GRCm39) Y1598C probably benign Het
Asic4 A G 1: 75,449,702 (GRCm39) D444G probably damaging Het
Cd3g A G 9: 44,891,587 (GRCm39) F11S probably benign Het
Dsp A G 13: 38,361,175 (GRCm39) T365A probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Golga3 C A 5: 110,368,774 (GRCm39) Q1365K probably damaging Het
Lama3 T A 18: 12,581,345 (GRCm39) H601Q probably benign Het
Lmbrd2 A G 15: 9,177,798 (GRCm39) D499G probably damaging Het
Or2aj6 A G 16: 19,443,515 (GRCm39) C112R probably damaging Het
Otop2 G A 11: 115,219,972 (GRCm39) A271T probably benign Het
Pigp T C 16: 94,165,583 (GRCm39) D113G possibly damaging Het
Prex1 G A 2: 166,451,701 (GRCm39) R256C probably damaging Het
Vmn1r67 T C 7: 10,181,356 (GRCm39) Y207H probably damaging Het
Other mutations in Stxbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Stxbp2 APN 8 3,686,354 (GRCm39) critical splice acceptor site probably null
IGL00466:Stxbp2 APN 8 3,684,065 (GRCm39) missense probably benign 0.29
IGL02315:Stxbp2 APN 8 3,685,607 (GRCm39) unclassified probably benign
IGL02508:Stxbp2 APN 8 3,682,531 (GRCm39) missense probably damaging 1.00
IGL02811:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02833:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02868:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02869:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02896:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02926:Stxbp2 APN 8 3,685,629 (GRCm39) missense probably benign 0.31
IGL02927:Stxbp2 APN 8 3,692,685 (GRCm39) missense possibly damaging 0.95
IGL02928:Stxbp2 APN 8 3,691,736 (GRCm39) missense probably damaging 0.99
IGL02943:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02945:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02948:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02951:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02972:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02976:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02977:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02983:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02993:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03008:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03009:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03038:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03051:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03061:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03072:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03110:Stxbp2 APN 8 3,683,342 (GRCm39) missense probably damaging 1.00
IGL02988:Stxbp2 UTSW 8 3,683,267 (GRCm39) intron probably benign
R0463:Stxbp2 UTSW 8 3,682,559 (GRCm39) missense probably damaging 1.00
R0608:Stxbp2 UTSW 8 3,682,559 (GRCm39) missense probably damaging 1.00
R0755:Stxbp2 UTSW 8 3,692,019 (GRCm39) missense probably benign 0.01
R1328:Stxbp2 UTSW 8 3,692,657 (GRCm39) missense possibly damaging 0.56
R1771:Stxbp2 UTSW 8 3,684,064 (GRCm39) missense probably benign 0.01
R1962:Stxbp2 UTSW 8 3,692,672 (GRCm39) missense probably benign 0.00
R2195:Stxbp2 UTSW 8 3,684,615 (GRCm39) splice site probably null
R2319:Stxbp2 UTSW 8 3,683,834 (GRCm39) missense possibly damaging 0.95
R3870:Stxbp2 UTSW 8 3,684,079 (GRCm39) missense probably damaging 1.00
R3876:Stxbp2 UTSW 8 3,683,369 (GRCm39) critical splice donor site probably null
R4703:Stxbp2 UTSW 8 3,682,521 (GRCm39) missense probably damaging 1.00
R6533:Stxbp2 UTSW 8 3,692,683 (GRCm39) missense probably benign 0.01
R6623:Stxbp2 UTSW 8 3,682,561 (GRCm39) missense probably damaging 1.00
R6665:Stxbp2 UTSW 8 3,691,998 (GRCm39) missense probably benign 0.41
R6798:Stxbp2 UTSW 8 3,691,180 (GRCm39) missense probably benign
R7152:Stxbp2 UTSW 8 3,682,583 (GRCm39) missense probably benign 0.33
R7326:Stxbp2 UTSW 8 3,691,151 (GRCm39) missense
R8237:Stxbp2 UTSW 8 3,685,695 (GRCm39) missense
R8268:Stxbp2 UTSW 8 3,682,234 (GRCm39) missense
R8709:Stxbp2 UTSW 8 3,683,914 (GRCm39) missense possibly damaging 0.50
R8811:Stxbp2 UTSW 8 3,689,541 (GRCm39) missense
R9018:Stxbp2 UTSW 8 3,692,627 (GRCm39) intron probably benign
R9043:Stxbp2 UTSW 8 3,684,478 (GRCm39) missense
R9048:Stxbp2 UTSW 8 3,687,218 (GRCm39) missense
R9212:Stxbp2 UTSW 8 3,686,220 (GRCm39) missense
R9421:Stxbp2 UTSW 8 3,682,264 (GRCm39) missense
R9643:Stxbp2 UTSW 8 3,686,392 (GRCm39) missense
Z1177:Stxbp2 UTSW 8 3,691,123 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCAGCTTCCTAGACGTAG -3'
(R):5'- CAACTTTGTTCTGCCAGCTG -3'

Sequencing Primer
(F):5'- CCAGCTTCCTAGACGTAGAGAGAG -3'
(R):5'- AGCTGCAACTGAGGGGC -3'
Posted On 2015-02-19