Incidental Mutation 'R3614:Stxbp2'
List |< first << previous [record 13 of 14] next >> last >|
ID268374
Institutional Source Beutler Lab
Gene Symbol Stxbp2
Ensembl Gene ENSMUSG00000004626
Gene Namesyntaxin binding protein 2
SynonymsmuSec1, Munc18b, Munc-18-2, C79054, Sxtp2, Munc-18b
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3614 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3630955-3643644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3631196 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 10 (V10E)
Ref Sequence ENSEMBL: ENSMUSP00000147220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159888] [ENSMUST00000159911] [ENSMUST00000160708] [ENSMUST00000162867]
Predicted Effect probably benign
Transcript: ENSMUST00000004745
AA Change: V9E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000004745
Gene: ENSMUSG00000004626
AA Change: V9E

DomainStartEndE-ValueType
Pfam:Sec1 29 580 6.8e-113 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159888
AA Change: V10E
Predicted Effect possibly damaging
Transcript: ENSMUST00000159911
AA Change: V10E

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000160708
AA Change: V10E

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125405
Gene: ENSMUSG00000004626
AA Change: V10E

DomainStartEndE-ValueType
Pfam:Sec1 29 579 4.9e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162737
Predicted Effect unknown
Transcript: ENSMUST00000162867
AA Change: V10E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163044
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality. Mice heterozygous for this allele exhibit decreased stimulated mucin secretion, release of histones in stimulated mast cells and decreased susceptibility to type I hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,575,727 Y1598C probably benign Het
Asic4 A G 1: 75,473,058 D444G probably damaging Het
Cd3g A G 9: 44,980,289 F11S probably benign Het
Dsp A G 13: 38,177,199 T365A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Golga3 C A 5: 110,220,908 Q1365K probably damaging Het
Lama3 T A 18: 12,448,288 H601Q probably benign Het
Lmbrd2 A G 15: 9,177,711 D499G probably damaging Het
Olfr171 A G 16: 19,624,765 C112R probably damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Pigp T C 16: 94,364,724 D113G possibly damaging Het
Prex1 G A 2: 166,609,781 R256C probably damaging Het
Vmn1r67 T C 7: 10,447,429 Y207H probably damaging Het
Other mutations in Stxbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Stxbp2 APN 8 3636354 critical splice acceptor site probably null
IGL00466:Stxbp2 APN 8 3634065 missense probably benign 0.29
IGL02315:Stxbp2 APN 8 3635607 unclassified probably benign
IGL02508:Stxbp2 APN 8 3632531 missense probably damaging 1.00
IGL02811:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02833:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02868:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02869:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02896:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02926:Stxbp2 APN 8 3635629 missense probably benign 0.31
IGL02927:Stxbp2 APN 8 3642685 missense possibly damaging 0.95
IGL02928:Stxbp2 APN 8 3641736 missense probably damaging 0.99
IGL02943:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02945:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02948:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02951:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02972:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02976:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02977:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02983:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02993:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03008:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03009:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03038:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03051:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03061:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03072:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03110:Stxbp2 APN 8 3633342 missense probably damaging 1.00
IGL02988:Stxbp2 UTSW 8 3633267 intron probably benign
R0463:Stxbp2 UTSW 8 3632559 missense probably damaging 1.00
R0608:Stxbp2 UTSW 8 3632559 missense probably damaging 1.00
R0755:Stxbp2 UTSW 8 3642019 missense probably benign 0.01
R1328:Stxbp2 UTSW 8 3642657 missense possibly damaging 0.56
R1771:Stxbp2 UTSW 8 3634064 missense probably benign 0.01
R1962:Stxbp2 UTSW 8 3642672 missense probably benign 0.00
R2195:Stxbp2 UTSW 8 3634615 synonymous probably null
R2319:Stxbp2 UTSW 8 3633834 missense possibly damaging 0.95
R3870:Stxbp2 UTSW 8 3634079 missense probably damaging 1.00
R3876:Stxbp2 UTSW 8 3633369 critical splice donor site probably null
R4703:Stxbp2 UTSW 8 3632521 missense probably damaging 1.00
R6533:Stxbp2 UTSW 8 3642683 missense probably benign 0.01
R6623:Stxbp2 UTSW 8 3632561 missense probably damaging 1.00
R6665:Stxbp2 UTSW 8 3641998 missense probably benign 0.41
R6798:Stxbp2 UTSW 8 3641180 missense probably benign
R7152:Stxbp2 UTSW 8 3632583 missense probably benign 0.33
R7326:Stxbp2 UTSW 8 3641151 missense
Z1177:Stxbp2 UTSW 8 3641123 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCAGCTTCCTAGACGTAG -3'
(R):5'- CAACTTTGTTCTGCCAGCTG -3'

Sequencing Primer
(F):5'- CCAGCTTCCTAGACGTAGAGAGAG -3'
(R):5'- AGCTGCAACTGAGGGGC -3'
Posted On2015-02-19