Incidental Mutation 'R3614:Cd3g'
ID268375
Institutional Source Beutler Lab
Gene Symbol Cd3g
Ensembl Gene ENSMUSG00000002033
Gene NameCD3 antigen, gamma polypeptide
SynonymsT3g, Ctg3, Ctg-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3614 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44969572-44980431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44980289 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 11 (F11S)
Ref Sequence ENSEMBL: ENSMUSP00000002101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002101] [ENSMUST00000034602] [ENSMUST00000160886]
PDB Structure
CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000002101
AA Change: F11S

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002101
Gene: ENSMUSG00000002033
AA Change: F11S

DomainStartEndE-ValueType
IGc2 37 94 3.51e-8 SMART
transmembrane domain 115 137 N/A INTRINSIC
ITAM 157 177 2.06e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034602
SMART Domains Protein: ENSMUSP00000034602
Gene: ENSMUSG00000032094

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_4 30 103 5.9e-23 PFAM
transmembrane domain 105 127 N/A INTRINSIC
ITAM 146 166 2.41e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160886
AA Change: F11S

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125151
Gene: ENSMUSG00000002033
AA Change: F11S

DomainStartEndE-ValueType
IGc2 29 86 3.51e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the CD3-gamma polypeptide, which together with CD3-epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thymocyte number and T cell response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,575,727 Y1598C probably benign Het
Asic4 A G 1: 75,473,058 D444G probably damaging Het
Dsp A G 13: 38,177,199 T365A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Golga3 C A 5: 110,220,908 Q1365K probably damaging Het
Lama3 T A 18: 12,448,288 H601Q probably benign Het
Lmbrd2 A G 15: 9,177,711 D499G probably damaging Het
Olfr171 A G 16: 19,624,765 C112R probably damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Pigp T C 16: 94,364,724 D113G possibly damaging Het
Prex1 G A 2: 166,609,781 R256C probably damaging Het
Stxbp2 T A 8: 3,631,196 V10E possibly damaging Het
Vmn1r67 T C 7: 10,447,429 Y207H probably damaging Het
Other mutations in Cd3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01881:Cd3g APN 9 44971268 missense probably damaging 1.00
IGL02624:Cd3g APN 9 44974161 critical splice donor site probably null
IGL02750:Cd3g APN 9 44971310 unclassified probably benign
IGL03097:Cd3g UTSW 9 44970763 missense probably damaging 1.00
R1711:Cd3g UTSW 9 44974342 missense probably damaging 1.00
R2076:Cd3g UTSW 9 44974297 missense probably damaging 1.00
R4514:Cd3g UTSW 9 44973584 missense possibly damaging 0.93
R5732:Cd3g UTSW 9 44973631 missense possibly damaging 0.89
R6520:Cd3g UTSW 9 44971315 splice site probably null
R7447:Cd3g UTSW 9 44973559 missense probably damaging 1.00
R7776:Cd3g UTSW 9 44974161 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGAAATCCTCTCTCCAGCCAG -3'
(R):5'- GGTATTGCCTCTACTCAGAGTCC -3'

Sequencing Primer
(F):5'- TGGTTCTTCCCAGCACAGAG -3'
(R):5'- GAGTCCCAGCTCAATGCATG -3'
Posted On2015-02-19