Incidental Mutation 'R3614:Lmbrd2'
ID268379
Institutional Source Beutler Lab
Gene Symbol Lmbrd2
Ensembl Gene ENSMUSG00000039704
Gene NameLMBR1 domain containing 2
Synonyms9930036E21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R3614 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9140550-9202483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9177711 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 499 (D499G)
Ref Sequence ENSEMBL: ENSMUSP00000154020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090380] [ENSMUST00000227556]
Predicted Effect probably damaging
Transcript: ENSMUST00000090380
AA Change: D454G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087858
Gene: ENSMUSG00000039704
AA Change: D454G

DomainStartEndE-ValueType
Pfam:LMBR1 8 546 4.2e-192 PFAM
low complexity region 574 598 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227216
Predicted Effect probably damaging
Transcript: ENSMUST00000227556
AA Change: D499G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,575,727 Y1598C probably benign Het
Asic4 A G 1: 75,473,058 D444G probably damaging Het
Cd3g A G 9: 44,980,289 F11S probably benign Het
Dsp A G 13: 38,177,199 T365A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Golga3 C A 5: 110,220,908 Q1365K probably damaging Het
Lama3 T A 18: 12,448,288 H601Q probably benign Het
Olfr171 A G 16: 19,624,765 C112R probably damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Pigp T C 16: 94,364,724 D113G possibly damaging Het
Prex1 G A 2: 166,609,781 R256C probably damaging Het
Stxbp2 T A 8: 3,631,196 V10E possibly damaging Het
Vmn1r67 T C 7: 10,447,429 Y207H probably damaging Het
Other mutations in Lmbrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Lmbrd2 APN 15 9157295 missense probably damaging 1.00
IGL00864:Lmbrd2 APN 15 9175210 missense probably damaging 1.00
IGL01554:Lmbrd2 APN 15 9165819 missense possibly damaging 0.96
IGL02142:Lmbrd2 APN 15 9186685 missense probably damaging 1.00
IGL02176:Lmbrd2 APN 15 9182574 missense probably damaging 1.00
IGL02293:Lmbrd2 APN 15 9172189 missense probably benign
IGL02692:Lmbrd2 APN 15 9149068 missense possibly damaging 0.94
IGL03101:Lmbrd2 APN 15 9186608 missense probably damaging 1.00
R0102:Lmbrd2 UTSW 15 9183952 missense probably damaging 1.00
R0370:Lmbrd2 UTSW 15 9165852 missense probably damaging 0.97
R0379:Lmbrd2 UTSW 15 9149479 missense probably benign 0.00
R0513:Lmbrd2 UTSW 15 9194729 missense probably damaging 1.00
R1610:Lmbrd2 UTSW 15 9186612 missense probably benign 0.19
R1628:Lmbrd2 UTSW 15 9182506 missense probably damaging 1.00
R1844:Lmbrd2 UTSW 15 9177751 nonsense probably null
R2422:Lmbrd2 UTSW 15 9194765 missense possibly damaging 0.83
R3924:Lmbrd2 UTSW 15 9149537 missense probably benign
R4014:Lmbrd2 UTSW 15 9151585 splice site probably benign
R4298:Lmbrd2 UTSW 15 9165795 missense possibly damaging 0.92
R5126:Lmbrd2 UTSW 15 9194701 missense possibly damaging 0.91
R5699:Lmbrd2 UTSW 15 9175182 missense probably benign 0.40
R5841:Lmbrd2 UTSW 15 9182570 missense possibly damaging 0.94
R5974:Lmbrd2 UTSW 15 9172115 missense probably benign 0.25
R5988:Lmbrd2 UTSW 15 9182406 intron probably null
R6179:Lmbrd2 UTSW 15 9149175 missense probably damaging 0.99
R6666:Lmbrd2 UTSW 15 9151569 missense probably benign 0.06
R7180:Lmbrd2 UTSW 15 9175196 missense possibly damaging 0.90
R7269:Lmbrd2 UTSW 15 9194684 missense probably damaging 1.00
R7341:Lmbrd2 UTSW 15 9165819 missense possibly damaging 0.96
R8066:Lmbrd2 UTSW 15 9172085 missense not run
Predicted Primers PCR Primer
(F):5'- GGCAGTTCATATGGAGAATTCAAAC -3'
(R):5'- AAACAGGTTTTGATGCTGCTC -3'

Sequencing Primer
(F):5'- ACAATGACCTGAAATGTCTTA -3'
(R):5'- GGAGTTCAATGTGCTACACA -3'
Posted On2015-02-19