Incidental Mutation 'R3614:Olfr171'
List |< first << previous [record 9 of 14] next >> last >|
ID268380
Institutional Source Beutler Lab
Gene Symbol Olfr171
Ensembl Gene ENSMUSG00000060480
Gene Nameolfactory receptor 171
SynonymsMOR273-1, MOR273-5, GA_x54KRFPKG5P-16071018-16070077
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3614 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19623930-19629916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19624765 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 112 (C112R)
Ref Sequence ENSEMBL: ENSMUSP00000145692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079891] [ENSMUST00000205467]
Predicted Effect probably damaging
Transcript: ENSMUST00000079891
AA Change: C113R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078814
Gene: ENSMUSG00000060480
AA Change: C113R

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 2.6e-43 PFAM
Pfam:7TM_GPCR_Srsx 36 261 8.6e-6 PFAM
Pfam:7tm_1 42 291 3.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205467
AA Change: C112R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,575,727 Y1598C probably benign Het
Asic4 A G 1: 75,473,058 D444G probably damaging Het
Cd3g A G 9: 44,980,289 F11S probably benign Het
Dsp A G 13: 38,177,199 T365A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Golga3 C A 5: 110,220,908 Q1365K probably damaging Het
Lama3 T A 18: 12,448,288 H601Q probably benign Het
Lmbrd2 A G 15: 9,177,711 D499G probably damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Pigp T C 16: 94,364,724 D113G possibly damaging Het
Prex1 G A 2: 166,609,781 R256C probably damaging Het
Stxbp2 T A 8: 3,631,196 V10E possibly damaging Het
Vmn1r67 T C 7: 10,447,429 Y207H probably damaging Het
Other mutations in Olfr171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Olfr171 APN 16 19624408 missense probably benign 0.03
IGL02256:Olfr171 APN 16 19625006 missense probably benign 0.07
IGL02572:Olfr171 APN 16 19625098 start codon destroyed probably benign 0.01
IGL02966:Olfr171 APN 16 19624301 missense probably damaging 1.00
R0062:Olfr171 UTSW 16 19624417 missense probably benign 0.10
R4899:Olfr171 UTSW 16 19624200 missense probably benign 0.33
R5070:Olfr171 UTSW 16 19624992 missense possibly damaging 0.47
R5334:Olfr171 UTSW 16 19624491 missense probably benign 0.02
R5718:Olfr171 UTSW 16 19624389 missense probably benign 0.06
R6490:Olfr171 UTSW 16 19624444 missense probably benign 0.03
R6632:Olfr171 UTSW 16 19625023 missense probably benign
R7801:Olfr171 UTSW 16 19624623 missense probably damaging 0.99
X0057:Olfr171 UTSW 16 19624926 missense probably damaging 1.00
X0063:Olfr171 UTSW 16 19624708 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGTGATCAATGGCCCTTGAG -3'
(R):5'- CTCATGATCCTCCTAATCCACAGG -3'

Sequencing Primer
(F):5'- TCAATGGCCCTTGAGTGGCAG -3'
(R):5'- AGGGATTCTCGACTCCATACC -3'
Posted On2015-02-19