Incidental Mutation 'R3616:Barhl1'
ID 268383
Institutional Source Beutler Lab
Gene Symbol Barhl1
Ensembl Gene ENSMUSG00000026805
Gene Name BarH like homeobox 1
Synonyms MBH2, Dres115
MMRRC Submission 040673-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.337) question?
Stock # R3616 (G1)
Quality Score 222
Status Validated
Chromosome 2
Chromosomal Location 28797691-28806680 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28801562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 161 (D161N)
Ref Sequence ENSEMBL: ENSMUSP00000109480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050776] [ENSMUST00000113847] [ENSMUST00000113849]
AlphaFold P63157
Predicted Effect possibly damaging
Transcript: ENSMUST00000050776
AA Change: D161N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053147
Gene: ENSMUSG00000026805
AA Change: D161N

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113847
AA Change: D161N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109478
Gene: ENSMUSG00000026805
AA Change: D161N

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113849
AA Change: D161N

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109480
Gene: ENSMUSG00000026805
AA Change: D161N

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124059
SMART Domains Protein: ENSMUSP00000134363
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 76 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174027
SMART Domains Protein: ENSMUSP00000134118
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
HOX 1 32 2.5e-3 SMART
low complexity region 101 113 N/A INTRINSIC
Meta Mutation Damage Score 0.0814 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive hearing loss starting at 2 weeks of age. Animals are completely deaf by 10 months of age and show degeneration of the inner and outer cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Kif1b A T 4: 149,346,740 (GRCm39) probably benign Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pard6b T C 2: 167,929,259 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Barhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Barhl1 APN 2 28,805,558 (GRCm39) missense probably benign 0.03
IGL02337:Barhl1 APN 2 28,801,431 (GRCm39) missense probably damaging 1.00
IGL03113:Barhl1 APN 2 28,805,468 (GRCm39) missense probably benign 0.03
R0449:Barhl1 UTSW 2 28,805,304 (GRCm39) missense probably benign 0.06
R1675:Barhl1 UTSW 2 28,805,423 (GRCm39) missense possibly damaging 0.86
R1829:Barhl1 UTSW 2 28,799,857 (GRCm39) missense probably damaging 1.00
R3615:Barhl1 UTSW 2 28,801,562 (GRCm39) missense possibly damaging 0.75
R4937:Barhl1 UTSW 2 28,799,785 (GRCm39) missense probably damaging 1.00
R5481:Barhl1 UTSW 2 28,805,352 (GRCm39) missense probably damaging 0.98
R6075:Barhl1 UTSW 2 28,805,231 (GRCm39) missense probably damaging 0.99
R6727:Barhl1 UTSW 2 28,805,495 (GRCm39) missense probably benign 0.01
R6728:Barhl1 UTSW 2 28,805,495 (GRCm39) missense probably benign 0.01
R7096:Barhl1 UTSW 2 28,799,726 (GRCm39) missense probably benign
R7123:Barhl1 UTSW 2 28,799,943 (GRCm39) splice site probably null
R7336:Barhl1 UTSW 2 28,799,855 (GRCm39) missense probably benign 0.40
R7339:Barhl1 UTSW 2 28,799,899 (GRCm39) missense probably damaging 1.00
R7584:Barhl1 UTSW 2 28,799,803 (GRCm39) missense probably damaging 0.99
R9070:Barhl1 UTSW 2 28,805,423 (GRCm39) missense probably benign 0.17
R9087:Barhl1 UTSW 2 28,805,231 (GRCm39) missense probably damaging 0.99
X0065:Barhl1 UTSW 2 28,805,351 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGTACCAGGTCTTGACC -3'
(R):5'- TTTCTTCAGGGAGCTGCCAG -3'

Sequencing Primer
(F):5'- AGGTCTTGACCTGCGTGTC -3'
(R):5'- GCTTTGGCCCCGTTCAC -3'
Posted On 2015-02-19