Incidental Mutation 'R3616:Or4b13'
ID 268384
Institutional Source Beutler Lab
Gene Symbol Or4b13
Ensembl Gene ENSMUSG00000075063
Gene Name olfactory receptor family 4 subfamily B member 13
Synonyms K20, Olfr142, GA_x6K02T2Q125-51607674-51606757, MOR227-2
MMRRC Submission 040673-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R3616 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 90082413-90083330 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90082753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 193 (E193G)
Ref Sequence ENSEMBL: ENSMUSP00000150216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099752] [ENSMUST00000213968]
AlphaFold Q60881
Predicted Effect possibly damaging
Transcript: ENSMUST00000099752
AA Change: E193G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097341
Gene: ENSMUSG00000075063
AA Change: E193G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 300 3e-6 PFAM
Pfam:7tm_1 39 285 5.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213968
AA Change: E193G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Kif1b A T 4: 149,346,740 (GRCm39) probably benign Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pard6b T C 2: 167,929,259 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Or4b13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Or4b13 APN 2 90,082,953 (GRCm39) missense probably damaging 1.00
IGL01623:Or4b13 APN 2 90,082,953 (GRCm39) missense probably damaging 1.00
IGL01810:Or4b13 APN 2 90,082,476 (GRCm39) nonsense probably null
IGL01918:Or4b13 APN 2 90,082,675 (GRCm39) missense probably damaging 1.00
IGL02619:Or4b13 APN 2 90,082,849 (GRCm39) missense probably damaging 0.97
IGL02732:Or4b13 APN 2 90,082,652 (GRCm39) missense probably damaging 1.00
IGL02738:Or4b13 APN 2 90,082,699 (GRCm39) missense possibly damaging 0.82
IGL02795:Or4b13 APN 2 90,082,906 (GRCm39) missense probably damaging 1.00
IGL02830:Or4b13 APN 2 90,083,125 (GRCm39) missense probably damaging 1.00
R0601:Or4b13 UTSW 2 90,083,278 (GRCm39) missense probably benign 0.05
R2004:Or4b13 UTSW 2 90,083,036 (GRCm39) missense probably benign 0.04
R2136:Or4b13 UTSW 2 90,082,597 (GRCm39) missense probably damaging 0.98
R2377:Or4b13 UTSW 2 90,083,255 (GRCm39) missense probably damaging 1.00
R3615:Or4b13 UTSW 2 90,082,753 (GRCm39) missense possibly damaging 0.94
R3777:Or4b13 UTSW 2 90,082,969 (GRCm39) missense probably damaging 1.00
R4763:Or4b13 UTSW 2 90,082,807 (GRCm39) missense probably damaging 1.00
R4765:Or4b13 UTSW 2 90,082,807 (GRCm39) missense probably damaging 1.00
R5421:Or4b13 UTSW 2 90,083,089 (GRCm39) missense probably benign 0.01
R5426:Or4b13 UTSW 2 90,082,955 (GRCm39) nonsense probably null
R6063:Or4b13 UTSW 2 90,082,771 (GRCm39) missense probably benign 0.40
R6717:Or4b13 UTSW 2 90,082,868 (GRCm39) missense probably benign 0.00
R6931:Or4b13 UTSW 2 90,083,121 (GRCm39) nonsense probably null
R6936:Or4b13 UTSW 2 90,082,678 (GRCm39) missense probably benign 0.17
R7013:Or4b13 UTSW 2 90,082,441 (GRCm39) missense possibly damaging 0.87
R7091:Or4b13 UTSW 2 90,082,807 (GRCm39) missense probably damaging 1.00
R7247:Or4b13 UTSW 2 90,083,165 (GRCm39) missense probably damaging 1.00
R8169:Or4b13 UTSW 2 90,082,442 (GRCm39) nonsense probably null
R8345:Or4b13 UTSW 2 90,082,561 (GRCm39) missense possibly damaging 0.50
R9222:Or4b13 UTSW 2 90,082,820 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAACAGGATGACCACTGTG -3'
(R):5'- GATGGCCTATGACCGCTATGTG -3'

Sequencing Primer
(F):5'- CAGGATGACCACTGTGATGTG -3'
(R):5'- CATCATGAGTCGTCAAGTGTGTCAC -3'
Posted On 2015-02-19