Incidental Mutation 'R3616:Aqr'
ID 268385
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Name aquarius
Synonyms
MMRRC Submission 040673-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3616 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 113931642-114005788 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113967368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 549 (I549N)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
AlphaFold Q8CFQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000043160
AA Change: I549N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: I549N

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102543
AA Change: I549N

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: I549N

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126701
Meta Mutation Damage Score 0.6468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Kif1b A T 4: 149,346,740 (GRCm39) probably benign Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pard6b T C 2: 167,929,259 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 113,956,423 (GRCm39) missense possibly damaging 0.90
IGL00694:Aqr APN 2 113,982,006 (GRCm39) missense probably damaging 1.00
IGL02113:Aqr APN 2 113,950,508 (GRCm39) nonsense probably null
IGL02297:Aqr APN 2 113,980,962 (GRCm39) missense probably benign 0.24
IGL02380:Aqr APN 2 113,940,417 (GRCm39) missense probably damaging 1.00
IGL02410:Aqr APN 2 113,967,398 (GRCm39) missense possibly damaging 0.85
IGL02413:Aqr APN 2 113,949,261 (GRCm39) missense possibly damaging 0.87
IGL02474:Aqr APN 2 113,943,127 (GRCm39) missense probably damaging 1.00
IGL02941:Aqr APN 2 113,943,835 (GRCm39) missense probably damaging 1.00
IGL02981:Aqr APN 2 113,965,305 (GRCm39) splice site probably benign
IGL03001:Aqr APN 2 113,977,400 (GRCm39) missense probably benign
IGL03092:Aqr APN 2 113,989,424 (GRCm39) missense probably benign 0.38
IGL03222:Aqr APN 2 113,951,737 (GRCm39) missense probably damaging 1.00
capricorn UTSW 2 113,936,363 (GRCm39) missense probably damaging 1.00
Goat UTSW 2 113,988,056 (GRCm39) missense probably damaging 1.00
Pliades UTSW 2 113,963,457 (GRCm39) missense probably damaging 1.00
sagittarius UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
Zodiac UTSW 2 113,938,590 (GRCm39) missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 113,961,215 (GRCm39) missense possibly damaging 0.94
R0103:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R0103:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R0152:Aqr UTSW 2 113,989,491 (GRCm39) missense probably benign 0.07
R0352:Aqr UTSW 2 114,000,533 (GRCm39) missense probably damaging 1.00
R0371:Aqr UTSW 2 113,988,085 (GRCm39) missense possibly damaging 0.80
R0374:Aqr UTSW 2 113,961,092 (GRCm39) missense probably damaging 1.00
R0550:Aqr UTSW 2 113,963,457 (GRCm39) missense probably damaging 1.00
R0604:Aqr UTSW 2 113,961,085 (GRCm39) missense probably benign 0.00
R0685:Aqr UTSW 2 113,971,458 (GRCm39) missense probably damaging 1.00
R1236:Aqr UTSW 2 113,947,136 (GRCm39) missense probably damaging 1.00
R1434:Aqr UTSW 2 113,980,890 (GRCm39) missense probably damaging 1.00
R1806:Aqr UTSW 2 113,992,133 (GRCm39) missense probably damaging 1.00
R2154:Aqr UTSW 2 113,967,485 (GRCm39) missense probably damaging 1.00
R2185:Aqr UTSW 2 113,961,015 (GRCm39) critical splice donor site probably null
R2377:Aqr UTSW 2 113,971,421 (GRCm39) missense possibly damaging 0.58
R2862:Aqr UTSW 2 113,967,398 (GRCm39) missense probably damaging 1.00
R3615:Aqr UTSW 2 113,967,368 (GRCm39) missense probably damaging 1.00
R3713:Aqr UTSW 2 113,949,150 (GRCm39) splice site probably benign
R3715:Aqr UTSW 2 113,949,150 (GRCm39) splice site probably benign
R4586:Aqr UTSW 2 113,943,058 (GRCm39) missense probably benign 0.06
R4663:Aqr UTSW 2 113,992,147 (GRCm39) nonsense probably null
R4809:Aqr UTSW 2 114,005,695 (GRCm39) utr 5 prime probably benign
R4887:Aqr UTSW 2 113,980,990 (GRCm39) missense probably damaging 1.00
R4888:Aqr UTSW 2 113,980,990 (GRCm39) missense probably damaging 1.00
R4952:Aqr UTSW 2 113,940,418 (GRCm39) missense probably damaging 1.00
R4974:Aqr UTSW 2 113,943,832 (GRCm39) missense probably damaging 1.00
R5050:Aqr UTSW 2 114,000,506 (GRCm39) critical splice donor site probably null
R5050:Aqr UTSW 2 113,943,090 (GRCm39) nonsense probably null
R5213:Aqr UTSW 2 113,943,808 (GRCm39) missense probably damaging 1.00
R5263:Aqr UTSW 2 113,947,059 (GRCm39) missense probably damaging 1.00
R5470:Aqr UTSW 2 113,988,056 (GRCm39) missense probably damaging 1.00
R5488:Aqr UTSW 2 113,963,554 (GRCm39) missense probably damaging 1.00
R5489:Aqr UTSW 2 113,963,554 (GRCm39) missense probably damaging 1.00
R5567:Aqr UTSW 2 113,979,451 (GRCm39) missense probably damaging 1.00
R5570:Aqr UTSW 2 113,979,451 (GRCm39) missense probably damaging 1.00
R5641:Aqr UTSW 2 113,979,515 (GRCm39) missense probably damaging 1.00
R5685:Aqr UTSW 2 113,986,746 (GRCm39) missense possibly damaging 0.87
R5963:Aqr UTSW 2 113,957,442 (GRCm39) missense probably damaging 1.00
R5992:Aqr UTSW 2 113,973,530 (GRCm39) nonsense probably null
R6015:Aqr UTSW 2 114,005,646 (GRCm39) start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 113,986,758 (GRCm39) missense possibly damaging 0.93
R6264:Aqr UTSW 2 113,940,445 (GRCm39) missense probably damaging 1.00
R6773:Aqr UTSW 2 113,979,477 (GRCm39) missense possibly damaging 0.64
R6877:Aqr UTSW 2 113,947,052 (GRCm39) nonsense probably null
R7211:Aqr UTSW 2 113,965,204 (GRCm39) missense probably benign 0.01
R7232:Aqr UTSW 2 113,936,363 (GRCm39) missense probably damaging 1.00
R7308:Aqr UTSW 2 113,934,543 (GRCm39) missense possibly damaging 0.86
R7396:Aqr UTSW 2 113,950,427 (GRCm39) nonsense probably null
R7490:Aqr UTSW 2 113,989,349 (GRCm39) critical splice donor site probably null
R7526:Aqr UTSW 2 113,938,590 (GRCm39) missense probably damaging 0.96
R7629:Aqr UTSW 2 113,945,074 (GRCm39) missense probably damaging 1.00
R7828:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R8037:Aqr UTSW 2 113,992,161 (GRCm39) missense probably damaging 1.00
R8166:Aqr UTSW 2 113,943,806 (GRCm39) missense possibly damaging 0.95
R8712:Aqr UTSW 2 113,949,358 (GRCm39) missense probably damaging 1.00
R8904:Aqr UTSW 2 113,967,474 (GRCm39) missense probably damaging 0.98
R9487:Aqr UTSW 2 113,934,528 (GRCm39) missense probably benign 0.04
R9527:Aqr UTSW 2 113,932,037 (GRCm39) missense probably benign 0.02
R9664:Aqr UTSW 2 113,971,396 (GRCm39) nonsense probably null
Z1176:Aqr UTSW 2 113,940,472 (GRCm39) missense probably benign 0.25
Z1176:Aqr UTSW 2 113,938,603 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGCAATCTTTAGAATACTCTGACAGTG -3'
(R):5'- CTGCTTTGGATTTCAGGCAG -3'

Sequencing Primer
(F):5'- ACTCTGGCTCAATTCTTAGTATTTAC -3'
(R):5'- CAGGCAGTCTGAGTATGGTGGC -3'
Posted On 2015-02-19