Incidental Mutation 'R3616:Smg5'
ID 268388
Institutional Source Beutler Lab
Gene Symbol Smg5
Ensembl Gene ENSMUSG00000001415
Gene Name Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission 040673-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3616 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 88336260-88362338 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88336451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 10 (S10G)
Ref Sequence ENSEMBL: ENSMUSP00000001451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451] [ENSMUST00000001456] [ENSMUST00000107552] [ENSMUST00000107553] [ENSMUST00000193872]
AlphaFold Q6ZPY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000001451
AA Change: S10G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415
AA Change: S10G

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001456
SMART Domains Protein: ENSMUSP00000001456
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107552
SMART Domains Protein: ENSMUSP00000103176
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107553
SMART Domains Protein: ENSMUSP00000103177
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193007
Predicted Effect probably benign
Transcript: ENSMUST00000193872
SMART Domains Protein: ENSMUSP00000141830
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194942
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMG5 is involved in nonsense-mediated mRNA decay (Ohnishi et al., 2003 [PubMed 14636577]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dpysl2 T A 14: 66,834,370 H107L probably damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Gm597 T C 1: 28,776,575 D792G probably benign Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Kif1b A T 4: 149,262,283 probably benign Het
Krt25 A C 11: 99,317,298 V368G possibly damaging Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp10 A G 7: 108,924,476 F599S probably benign Het
Nlrp12 T A 7: 3,240,575 M436L probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pard6b T C 2: 168,087,339 probably benign Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss21 A G 17: 23,872,831 T258A probably benign Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Wdr20 A G 12: 110,793,939 T420A probably benign Het
Other mutations in Smg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smg5 APN 3 88351428 nonsense probably null
IGL00902:Smg5 APN 3 88353085 missense probably benign 0.00
IGL00990:Smg5 APN 3 88343038 critical splice donor site probably null
IGL01371:Smg5 APN 3 88359644 unclassified probably benign
IGL01536:Smg5 APN 3 88349245 missense possibly damaging 0.58
IGL02215:Smg5 APN 3 88352998 missense possibly damaging 0.47
IGL03366:Smg5 APN 3 88346452 nonsense probably null
R0013:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0129:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0153:Smg5 UTSW 3 88353872 unclassified probably benign
R1386:Smg5 UTSW 3 88355671 missense probably damaging 1.00
R1941:Smg5 UTSW 3 88345380 missense possibly damaging 0.71
R2185:Smg5 UTSW 3 88351561 missense probably benign
R2282:Smg5 UTSW 3 88345398 missense probably benign 0.02
R3615:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4008:Smg5 UTSW 3 88349158 missense probably benign 0.01
R4687:Smg5 UTSW 3 88342469 missense possibly damaging 0.83
R4726:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4801:Smg5 UTSW 3 88355692 nonsense probably null
R4802:Smg5 UTSW 3 88355692 nonsense probably null
R4977:Smg5 UTSW 3 88355725 nonsense probably null
R5384:Smg5 UTSW 3 88351293 missense probably damaging 1.00
R5443:Smg5 UTSW 3 88354589 missense probably damaging 0.99
R5779:Smg5 UTSW 3 88351618 unclassified probably benign
R5860:Smg5 UTSW 3 88342907 missense probably damaging 0.97
R6080:Smg5 UTSW 3 88351509 missense probably benign
R6263:Smg5 UTSW 3 88341901 missense possibly damaging 0.90
R6431:Smg5 UTSW 3 88351220 missense probably benign 0.00
R6722:Smg5 UTSW 3 88353025 missense probably damaging 0.99
R6847:Smg5 UTSW 3 88342552 missense probably damaging 1.00
R6950:Smg5 UTSW 3 88349269 critical splice donor site probably null
R7091:Smg5 UTSW 3 88351347 missense probably benign 0.00
R7395:Smg5 UTSW 3 88361071 missense probably damaging 0.99
R7678:Smg5 UTSW 3 88353895 missense possibly damaging 0.93
R7796:Smg5 UTSW 3 88349432 missense probably damaging 0.96
R8209:Smg5 UTSW 3 88351531 missense probably benign 0.00
R8327:Smg5 UTSW 3 88345407 missense probably damaging 1.00
R8987:Smg5 UTSW 3 88360407 critical splice donor site probably null
R9345:Smg5 UTSW 3 88354541 missense probably damaging 1.00
R9534:Smg5 UTSW 3 88345452 missense probably benign 0.13
R9602:Smg5 UTSW 3 88342907 missense probably damaging 1.00
Z1177:Smg5 UTSW 3 88351134 missense probably damaging 1.00
Z1177:Smg5 UTSW 3 88352990 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GACTTAAGCCCAGCAGAAGC -3'
(R):5'- TAGGGTTCTGAGCACCAGTC -3'

Sequencing Primer
(F):5'- AAGGCAATTTTTCGCGAGAC -3'
(R):5'- TGAGCACCAGTCCCTTTCGG -3'
Posted On 2015-02-19