Incidental Mutation 'R3616:Smg5'
ID 268388
Institutional Source Beutler Lab
Gene Symbol Smg5
Ensembl Gene ENSMUSG00000001415
Gene Name SMG5 nonsense mediated mRNA decay factor
Synonyms Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)
MMRRC Submission 040673-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3616 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 88243567-88269645 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88243758 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 10 (S10G)
Ref Sequence ENSEMBL: ENSMUSP00000001451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451] [ENSMUST00000001456] [ENSMUST00000107552] [ENSMUST00000107553] [ENSMUST00000193872]
AlphaFold Q6ZPY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000001451
AA Change: S10G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415
AA Change: S10G

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001456
SMART Domains Protein: ENSMUSP00000001456
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107552
SMART Domains Protein: ENSMUSP00000103176
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107553
SMART Domains Protein: ENSMUSP00000103177
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193007
Predicted Effect probably benign
Transcript: ENSMUST00000193872
SMART Domains Protein: ENSMUSP00000141830
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194942
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMG5 is involved in nonsense-mediated mRNA decay (Ohnishi et al., 2003 [PubMed 14636577]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Kif1b A T 4: 149,346,740 (GRCm39) probably benign Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pard6b T C 2: 167,929,259 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Smg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smg5 APN 3 88,258,735 (GRCm39) nonsense probably null
IGL00902:Smg5 APN 3 88,260,392 (GRCm39) missense probably benign 0.00
IGL00990:Smg5 APN 3 88,250,345 (GRCm39) critical splice donor site probably null
IGL01371:Smg5 APN 3 88,266,951 (GRCm39) unclassified probably benign
IGL01536:Smg5 APN 3 88,256,552 (GRCm39) missense possibly damaging 0.58
IGL02215:Smg5 APN 3 88,260,305 (GRCm39) missense possibly damaging 0.47
IGL03366:Smg5 APN 3 88,253,759 (GRCm39) nonsense probably null
R0013:Smg5 UTSW 3 88,256,540 (GRCm39) missense probably benign 0.00
R0017:Smg5 UTSW 3 88,258,412 (GRCm39) missense probably damaging 1.00
R0017:Smg5 UTSW 3 88,258,412 (GRCm39) missense probably damaging 1.00
R0129:Smg5 UTSW 3 88,256,540 (GRCm39) missense probably benign 0.00
R0153:Smg5 UTSW 3 88,261,179 (GRCm39) unclassified probably benign
R1386:Smg5 UTSW 3 88,262,978 (GRCm39) missense probably damaging 1.00
R1941:Smg5 UTSW 3 88,252,687 (GRCm39) missense possibly damaging 0.71
R2185:Smg5 UTSW 3 88,258,868 (GRCm39) missense probably benign
R2282:Smg5 UTSW 3 88,252,705 (GRCm39) missense probably benign 0.02
R3615:Smg5 UTSW 3 88,243,758 (GRCm39) missense possibly damaging 0.94
R4008:Smg5 UTSW 3 88,256,465 (GRCm39) missense probably benign 0.01
R4687:Smg5 UTSW 3 88,249,776 (GRCm39) missense possibly damaging 0.83
R4726:Smg5 UTSW 3 88,243,758 (GRCm39) missense possibly damaging 0.94
R4801:Smg5 UTSW 3 88,262,999 (GRCm39) nonsense probably null
R4802:Smg5 UTSW 3 88,262,999 (GRCm39) nonsense probably null
R4977:Smg5 UTSW 3 88,263,032 (GRCm39) nonsense probably null
R5384:Smg5 UTSW 3 88,258,600 (GRCm39) missense probably damaging 1.00
R5443:Smg5 UTSW 3 88,261,896 (GRCm39) missense probably damaging 0.99
R5779:Smg5 UTSW 3 88,258,925 (GRCm39) unclassified probably benign
R5860:Smg5 UTSW 3 88,250,214 (GRCm39) missense probably damaging 0.97
R6080:Smg5 UTSW 3 88,258,816 (GRCm39) missense probably benign
R6263:Smg5 UTSW 3 88,249,208 (GRCm39) missense possibly damaging 0.90
R6431:Smg5 UTSW 3 88,258,527 (GRCm39) missense probably benign 0.00
R6722:Smg5 UTSW 3 88,260,332 (GRCm39) missense probably damaging 0.99
R6847:Smg5 UTSW 3 88,249,859 (GRCm39) missense probably damaging 1.00
R6950:Smg5 UTSW 3 88,256,576 (GRCm39) critical splice donor site probably null
R7091:Smg5 UTSW 3 88,258,654 (GRCm39) missense probably benign 0.00
R7395:Smg5 UTSW 3 88,268,378 (GRCm39) missense probably damaging 0.99
R7678:Smg5 UTSW 3 88,261,202 (GRCm39) missense possibly damaging 0.93
R7796:Smg5 UTSW 3 88,256,739 (GRCm39) missense probably damaging 0.96
R8209:Smg5 UTSW 3 88,258,838 (GRCm39) missense probably benign 0.00
R8327:Smg5 UTSW 3 88,252,714 (GRCm39) missense probably damaging 1.00
R8987:Smg5 UTSW 3 88,267,714 (GRCm39) critical splice donor site probably null
R9345:Smg5 UTSW 3 88,261,848 (GRCm39) missense probably damaging 1.00
R9534:Smg5 UTSW 3 88,252,759 (GRCm39) missense probably benign 0.13
R9602:Smg5 UTSW 3 88,250,214 (GRCm39) missense probably damaging 1.00
Z1177:Smg5 UTSW 3 88,260,297 (GRCm39) missense probably benign 0.33
Z1177:Smg5 UTSW 3 88,258,441 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTAAGCCCAGCAGAAGC -3'
(R):5'- TAGGGTTCTGAGCACCAGTC -3'

Sequencing Primer
(F):5'- AAGGCAATTTTTCGCGAGAC -3'
(R):5'- TGAGCACCAGTCCCTTTCGG -3'
Posted On 2015-02-19