Incidental Mutation 'R3616:Kif1b'
ID268394
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Namekinesin family member 1B
SynonymsKif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission 040673-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3616 (G1)
Quality Score209
Status Validated
Chromosome4
Chromosomal Location149176319-149307693 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 149262283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030806] [ENSMUST00000055647] [ENSMUST00000060537]
Predicted Effect probably benign
Transcript: ENSMUST00000030806
SMART Domains Protein: ENSMUSP00000030806
Gene: ENSMUSG00000063077

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 660 N/A INTRINSIC
coiled coil region 814 858 N/A INTRINSIC
low complexity region 889 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055647
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060537
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150230
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dpysl2 T A 14: 66,834,370 H107L probably damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Gm597 T C 1: 28,776,575 D792G probably benign Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Krt25 A C 11: 99,317,298 V368G possibly damaging Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp10 A G 7: 108,924,476 F599S probably benign Het
Nlrp12 T A 7: 3,240,575 M436L probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pard6b T C 2: 168,087,339 probably benign Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss21 A G 17: 23,872,831 T258A probably benign Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Wdr20 A G 12: 110,793,939 T420A probably benign Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149220602 missense probably damaging 1.00
IGL01943:Kif1b APN 4 149214905 critical splice donor site probably null
IGL02240:Kif1b APN 4 149246414 missense probably damaging 1.00
IGL02414:Kif1b APN 4 149199314 missense probably damaging 0.96
IGL02490:Kif1b APN 4 149204208 missense probably benign
IGL02501:Kif1b APN 4 149214976 missense probably damaging 1.00
IGL02833:Kif1b APN 4 149246364 missense probably damaging 1.00
IGL02852:Kif1b APN 4 149291328 missense probably damaging 1.00
IGL02900:Kif1b APN 4 149180809 missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149214981 missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149274939 missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149220792 critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149181927 missense probably damaging 1.00
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0129:Kif1b UTSW 4 149261201 missense probably benign
R0180:Kif1b UTSW 4 149213659 missense probably damaging 1.00
R0288:Kif1b UTSW 4 149199338 missense probably damaging 1.00
R0360:Kif1b UTSW 4 149262729 missense probably damaging 1.00
R0383:Kif1b UTSW 4 149202512 missense probably damaging 1.00
R0398:Kif1b UTSW 4 149204231 missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149181967 nonsense probably null
R0445:Kif1b UTSW 4 149188009 missense probably benign 0.01
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1681:Kif1b UTSW 4 149195501 critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149187722 missense probably damaging 0.99
R1840:Kif1b UTSW 4 149188132 missense probably damaging 1.00
R1874:Kif1b UTSW 4 149187632 missense probably benign
R1915:Kif1b UTSW 4 149267216 missense probably damaging 1.00
R2106:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149222296 missense probably benign 0.08
R2126:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149184309 missense probably damaging 0.99
R2255:Kif1b UTSW 4 149274997 missense probably damaging 1.00
R2392:Kif1b UTSW 4 149220620 missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149237648 missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149220541 critical splice donor site probably null
R3038:Kif1b UTSW 4 149213333 missense probably benign 0.02
R3935:Kif1b UTSW 4 149237160 missense probably benign 0.00
R4347:Kif1b UTSW 4 149247234 missense probably damaging 1.00
R4423:Kif1b UTSW 4 149214105 missense probably damaging 0.99
R4637:Kif1b UTSW 4 149199311 missense probably damaging 0.97
R4745:Kif1b UTSW 4 149237882 nonsense probably null
R4807:Kif1b UTSW 4 149247921 intron probably benign
R5618:Kif1b UTSW 4 149269889 missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149238482 missense probably damaging 0.96
R5683:Kif1b UTSW 4 149222261 missense probably damaging 1.00
R5696:Kif1b UTSW 4 149273849 splice site probably null
R6022:Kif1b UTSW 4 149198532 missense probably benign 0.01
R6048:Kif1b UTSW 4 149263629 missense probably damaging 1.00
R6137:Kif1b UTSW 4 149238426 missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149237532 missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149258048 missense probably damaging 1.00
R6250:Kif1b UTSW 4 149213643 missense probably benign 0.00
R6423:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6424:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6425:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6443:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6460:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6462:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6463:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6469:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6470:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6471:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6472:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6504:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6536:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6537:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6668:Kif1b UTSW 4 149213407 missense probably benign 0.09
R6698:Kif1b UTSW 4 149274956 missense probably damaging 0.99
R7065:Kif1b UTSW 4 149202525 missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149225157 missense probably damaging 1.00
R7342:Kif1b UTSW 4 149214090 missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149182355 missense probably benign 0.01
R7744:Kif1b UTSW 4 149237075 missense possibly damaging 0.83
R7797:Kif1b UTSW 4 149237387 missense probably benign
R7829:Kif1b UTSW 4 149220990 splice site probably null
R7869:Kif1b UTSW 4 149184376 missense probably benign 0.01
R7878:Kif1b UTSW 4 149214997 missense probably damaging 0.98
R7980:Kif1b UTSW 4 149269921 missense probably damaging 1.00
R8047:Kif1b UTSW 4 149214922 missense probably damaging 1.00
R8237:Kif1b UTSW 4 149191185 missense probably benign 0.10
R8243:Kif1b UTSW 4 149204267 missense probably benign
R8252:Kif1b UTSW 4 149273805 missense probably damaging 1.00
R8342:Kif1b UTSW 4 149222348 missense probably damaging 0.96
RF008:Kif1b UTSW 4 149251738 splice site probably null
X0009:Kif1b UTSW 4 149247264 missense probably damaging 1.00
X0062:Kif1b UTSW 4 149275005 missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149266298 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTGTTTCACTGGCACCACC -3'
(R):5'- CAGTTTCATTGGGATAAATGAGAGG -3'

Sequencing Primer
(F):5'- GCTGGCCTTGAACTCAGTAAGATC -3'
(R):5'- TTTGTAATAGGCTGACAAACTGGG -3'
Posted On2015-02-19