Incidental Mutation 'R3616:Fiz1'
ID 268397
Institutional Source Beutler Lab
Gene Symbol Fiz1
Ensembl Gene ENSMUSG00000061374
Gene Name Flt3 interacting zinc finger protein 1
Synonyms
MMRRC Submission 040673-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R3616 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 5010058-5017696 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5011171 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 449 (L449P)
Ref Sequence ENSEMBL: ENSMUSP00000147011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077385] [ENSMUST00000165320] [ENSMUST00000167804] [ENSMUST00000207030] [ENSMUST00000207412] [ENSMUST00000207946] [ENSMUST00000208944] [ENSMUST00000209060]
AlphaFold Q9WTJ4
Predicted Effect probably benign
Transcript: ENSMUST00000077385
AA Change: L449P

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076603
Gene: ENSMUSG00000061374
AA Change: L449P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165320
AA Change: L449P

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128105
Gene: ENSMUSG00000061374
AA Change: L449P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167804
AA Change: L449P

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126765
Gene: ENSMUSG00000061374
AA Change: L449P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207030
AA Change: L449P

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000207412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207691
Predicted Effect probably benign
Transcript: ENSMUST00000207946
Predicted Effect probably benign
Transcript: ENSMUST00000208944
AA Change: L449P

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000209060
Meta Mutation Damage Score 0.0955 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes zinc finger protein, which interacts with a receptor tyrosine kinase involved in the regulation of hematopoietic and lymphoid cells. This gene product also interacts with a transcription factor that regulates the expression of rod-specific genes in retina. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Kif1b A T 4: 149,346,740 (GRCm39) probably benign Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pard6b T C 2: 167,929,259 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Fiz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02606:Fiz1 APN 7 5,012,158 (GRCm39) missense possibly damaging 0.96
R0282:Fiz1 UTSW 7 5,012,200 (GRCm39) missense probably benign 0.33
R0548:Fiz1 UTSW 7 5,012,167 (GRCm39) missense possibly damaging 0.86
R1693:Fiz1 UTSW 7 5,011,727 (GRCm39) missense probably benign
R2054:Fiz1 UTSW 7 5,011,235 (GRCm39) missense probably damaging 1.00
R2151:Fiz1 UTSW 7 5,015,880 (GRCm39) missense possibly damaging 0.60
R2204:Fiz1 UTSW 7 5,011,685 (GRCm39) missense probably benign 0.01
R3427:Fiz1 UTSW 7 5,015,708 (GRCm39) missense probably damaging 1.00
R3615:Fiz1 UTSW 7 5,011,171 (GRCm39) missense probably benign 0.36
R4690:Fiz1 UTSW 7 5,012,167 (GRCm39) missense probably benign 0.33
R5554:Fiz1 UTSW 7 5,015,849 (GRCm39) missense probably damaging 1.00
R6340:Fiz1 UTSW 7 5,011,400 (GRCm39) missense possibly damaging 0.94
R6343:Fiz1 UTSW 7 5,011,400 (GRCm39) missense possibly damaging 0.94
R6586:Fiz1 UTSW 7 5,011,400 (GRCm39) missense possibly damaging 0.94
R6587:Fiz1 UTSW 7 5,011,400 (GRCm39) missense possibly damaging 0.94
R7999:Fiz1 UTSW 7 5,011,997 (GRCm39) missense probably benign 0.00
R8348:Fiz1 UTSW 7 5,015,909 (GRCm39) missense probably benign 0.33
R8531:Fiz1 UTSW 7 5,012,163 (GRCm39) nonsense probably null
R8875:Fiz1 UTSW 7 5,012,093 (GRCm39) missense probably benign 0.00
R9154:Fiz1 UTSW 7 5,011,280 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCTGGTTATTCAGTCCATG -3'
(R):5'- CAGCCATTTAGAGGCTCACTC -3'

Sequencing Primer
(F):5'- ATGCCCCTGTGTAGCTTCAGATG -3'
(R):5'- CGTGCAAGCCATGGTGAG -3'
Posted On 2015-02-19