Incidental Mutation 'R3616:Grik5'
ID 268398
Institutional Source Beutler Lab
Gene Symbol Grik5
Ensembl Gene ENSMUSG00000003378
Gene Name glutamate receptor, ionotropic, kainate 5 (gamma 2)
Synonyms KA2, GluRgamma2
MMRRC Submission 040673-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R3616 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 24709274-24771771 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24721996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 581 (A581T)
Ref Sequence ENSEMBL: ENSMUSP00000003468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000205328] [ENSMUST00000206134]
AlphaFold Q61626
Predicted Effect probably benign
Transcript: ENSMUST00000003468
AA Change: A581T

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: A581T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 40 381 3.4e-64 PFAM
PBPe 416 785 3.7e-122 SMART
Lig_chan-Glu_bd 426 490 1.65e-29 SMART
transmembrane domain 804 823 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 893 921 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205328
Predicted Effect probably benign
Transcript: ENSMUST00000206134
Meta Mutation Damage Score 0.0862 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Kif1b A T 4: 149,346,740 (GRCm39) probably benign Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pard6b T C 2: 167,929,259 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Grik5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Grik5 APN 7 24,764,818 (GRCm39) missense probably damaging 1.00
IGL00974:Grik5 APN 7 24,713,310 (GRCm39) missense probably damaging 1.00
IGL01941:Grik5 APN 7 24,764,607 (GRCm39) missense probably damaging 1.00
IGL02642:Grik5 APN 7 24,758,408 (GRCm39) missense possibly damaging 0.51
IGL03177:Grik5 APN 7 24,714,879 (GRCm39) missense probably damaging 1.00
IGL03402:Grik5 APN 7 24,714,894 (GRCm39) missense probably damaging 1.00
Griffin UTSW 7 24,758,502 (GRCm39) missense possibly damaging 0.78
G1citation:Grik5 UTSW 7 24,745,780 (GRCm39) missense possibly damaging 0.46
PIT4453001:Grik5 UTSW 7 24,710,119 (GRCm39) missense probably damaging 0.99
R0077:Grik5 UTSW 7 24,722,805 (GRCm39) missense probably damaging 1.00
R0412:Grik5 UTSW 7 24,713,099 (GRCm39) missense possibly damaging 0.59
R0427:Grik5 UTSW 7 24,757,923 (GRCm39) missense probably benign 0.34
R1191:Grik5 UTSW 7 24,757,750 (GRCm39) nonsense probably null
R1830:Grik5 UTSW 7 24,745,726 (GRCm39) missense possibly damaging 0.94
R2072:Grik5 UTSW 7 24,714,738 (GRCm39) missense possibly damaging 0.92
R2369:Grik5 UTSW 7 24,757,962 (GRCm39) missense probably damaging 1.00
R3410:Grik5 UTSW 7 24,762,397 (GRCm39) missense probably benign 0.04
R3411:Grik5 UTSW 7 24,762,397 (GRCm39) missense probably benign 0.04
R3615:Grik5 UTSW 7 24,721,996 (GRCm39) missense probably benign 0.37
R4600:Grik5 UTSW 7 24,767,489 (GRCm39) missense probably damaging 0.99
R4658:Grik5 UTSW 7 24,760,152 (GRCm39) splice site probably benign
R4735:Grik5 UTSW 7 24,757,713 (GRCm39) missense probably damaging 1.00
R4810:Grik5 UTSW 7 24,714,922 (GRCm39) missense probably damaging 0.98
R5113:Grik5 UTSW 7 24,714,952 (GRCm39) missense probably damaging 1.00
R5120:Grik5 UTSW 7 24,710,065 (GRCm39) missense probably damaging 1.00
R5132:Grik5 UTSW 7 24,764,629 (GRCm39) missense probably benign 0.02
R5173:Grik5 UTSW 7 24,762,319 (GRCm39) missense possibly damaging 0.76
R5186:Grik5 UTSW 7 24,715,244 (GRCm39) missense probably damaging 1.00
R5239:Grik5 UTSW 7 24,764,895 (GRCm39) missense probably damaging 1.00
R5935:Grik5 UTSW 7 24,758,502 (GRCm39) missense possibly damaging 0.78
R6335:Grik5 UTSW 7 24,713,019 (GRCm39) missense probably benign
R6609:Grik5 UTSW 7 24,714,951 (GRCm39) nonsense probably null
R6760:Grik5 UTSW 7 24,758,364 (GRCm39) critical splice donor site probably null
R6820:Grik5 UTSW 7 24,745,780 (GRCm39) missense possibly damaging 0.46
R6821:Grik5 UTSW 7 24,745,780 (GRCm39) missense possibly damaging 0.46
R6822:Grik5 UTSW 7 24,745,780 (GRCm39) missense possibly damaging 0.46
R6824:Grik5 UTSW 7 24,745,780 (GRCm39) missense possibly damaging 0.46
R7173:Grik5 UTSW 7 24,767,587 (GRCm39) missense probably damaging 1.00
R7230:Grik5 UTSW 7 24,722,495 (GRCm39) missense probably damaging 1.00
R7555:Grik5 UTSW 7 24,760,022 (GRCm39) missense probably benign
R7560:Grik5 UTSW 7 24,757,951 (GRCm39) missense probably damaging 0.99
R7571:Grik5 UTSW 7 24,713,310 (GRCm39) missense possibly damaging 0.87
R8228:Grik5 UTSW 7 24,745,735 (GRCm39) missense possibly damaging 0.93
R8228:Grik5 UTSW 7 24,709,933 (GRCm39) missense probably damaging 1.00
R8681:Grik5 UTSW 7 24,709,897 (GRCm39) missense probably benign 0.06
R8879:Grik5 UTSW 7 24,722,489 (GRCm39) missense possibly damaging 0.95
R8933:Grik5 UTSW 7 24,722,743 (GRCm39) missense probably benign 0.11
R9129:Grik5 UTSW 7 24,767,429 (GRCm39) splice site probably benign
R9130:Grik5 UTSW 7 24,767,429 (GRCm39) splice site probably benign
R9154:Grik5 UTSW 7 24,758,403 (GRCm39) missense probably damaging 1.00
R9317:Grik5 UTSW 7 24,745,660 (GRCm39) missense probably damaging 0.99
R9355:Grik5 UTSW 7 24,767,597 (GRCm39) missense possibly damaging 0.82
R9406:Grik5 UTSW 7 24,757,969 (GRCm39) missense probably benign 0.00
X0017:Grik5 UTSW 7 24,760,013 (GRCm39) missense probably damaging 1.00
Z1176:Grik5 UTSW 7 24,713,229 (GRCm39) missense probably damaging 0.98
Z1177:Grik5 UTSW 7 24,715,250 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCCCATATCCCCAGAATGG -3'
(R):5'- ACTGCAGTATCCGTTCCTGG -3'

Sequencing Primer
(F):5'- TGGAAGGCCTCCCAATTTAG -3'
(R):5'- GGCGTGTCAGCATCTCTG -3'
Posted On 2015-02-19