Incidental Mutation 'R3616:Gse1'
ID 268404
Institutional Source Beutler Lab
Gene Symbol Gse1
Ensembl Gene ENSMUSG00000031822
Gene Name genetic suppressor element 1, coiled-coil protein
Synonyms
MMRRC Submission 040673-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R3616 (G1)
Quality Score 179
Status Validated
Chromosome 8
Chromosomal Location 120955233-121308122 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) C to G at 121299481 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034279] [ENSMUST00000118136] [ENSMUST00000120493] [ENSMUST00000127664]
AlphaFold Q3U3C9
Predicted Effect unknown
Transcript: ENSMUST00000034279
AA Change: P837R
SMART Domains Protein: ENSMUSP00000034279
Gene: ENSMUSG00000031822
AA Change: P837R

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Pfam:DUF3736 81 216 2.9e-21 PFAM
coiled coil region 329 414 N/A INTRINSIC
Pfam:DUF3736 742 883 9.7e-46 PFAM
low complexity region 959 973 N/A INTRINSIC
low complexity region 1103 1124 N/A INTRINSIC
coiled coil region 1133 1207 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118136
AA Change: P827R
SMART Domains Protein: ENSMUSP00000112981
Gene: ENSMUSG00000031822
AA Change: P827R

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
Pfam:DUF3736 70 203 2.2e-39 PFAM
low complexity region 204 211 N/A INTRINSIC
coiled coil region 319 404 N/A INTRINSIC
Pfam:DUF3736 731 874 7.5e-48 PFAM
low complexity region 949 963 N/A INTRINSIC
low complexity region 1093 1114 N/A INTRINSIC
coiled coil region 1123 1197 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120493
AA Change: P824R
SMART Domains Protein: ENSMUSP00000113577
Gene: ENSMUSG00000031822
AA Change: P824R

DomainStartEndE-ValueType
low complexity region 48 60 N/A INTRINSIC
Pfam:DUF3736 67 200 2.2e-39 PFAM
low complexity region 201 208 N/A INTRINSIC
coiled coil region 316 401 N/A INTRINSIC
Pfam:DUF3736 728 871 7.5e-48 PFAM
low complexity region 946 960 N/A INTRINSIC
low complexity region 1090 1111 N/A INTRINSIC
coiled coil region 1120 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147327
Meta Mutation Damage Score 0.1471 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Kif1b A T 4: 149,346,740 (GRCm39) probably benign Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pard6b T C 2: 167,929,259 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Gse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Gse1 APN 8 121,280,326 (GRCm39) start codon destroyed probably null 0.79
IGL02484:Gse1 APN 8 121,302,001 (GRCm39) intron probably benign
IGL02931:Gse1 APN 8 121,304,808 (GRCm39) intron probably benign
IGL03193:Gse1 APN 8 121,298,079 (GRCm39) critical splice donor site probably null
R0027:Gse1 UTSW 8 121,293,285 (GRCm39) intron probably benign
R0109:Gse1 UTSW 8 121,294,524 (GRCm39) missense probably damaging 1.00
R0257:Gse1 UTSW 8 121,299,073 (GRCm39) intron probably benign
R0967:Gse1 UTSW 8 121,297,594 (GRCm39) intron probably benign
R1395:Gse1 UTSW 8 121,301,738 (GRCm39) intron probably benign
R1480:Gse1 UTSW 8 121,299,133 (GRCm39) intron probably benign
R1532:Gse1 UTSW 8 121,294,949 (GRCm39) intron probably benign
R1649:Gse1 UTSW 8 121,305,254 (GRCm39) intron probably benign
R1728:Gse1 UTSW 8 121,294,992 (GRCm39) intron probably benign
R1742:Gse1 UTSW 8 121,293,689 (GRCm39) missense probably damaging 1.00
R1784:Gse1 UTSW 8 121,294,992 (GRCm39) intron probably benign
R2081:Gse1 UTSW 8 121,293,219 (GRCm39) missense probably damaging 1.00
R2110:Gse1 UTSW 8 121,293,719 (GRCm39) missense probably damaging 1.00
R2974:Gse1 UTSW 8 121,297,636 (GRCm39) intron probably benign
R3615:Gse1 UTSW 8 121,299,481 (GRCm39) intron probably benign
R3857:Gse1 UTSW 8 121,297,872 (GRCm39) intron probably benign
R4201:Gse1 UTSW 8 121,294,503 (GRCm39) missense probably benign 0.39
R4494:Gse1 UTSW 8 121,297,553 (GRCm39) intron probably benign
R4857:Gse1 UTSW 8 121,299,496 (GRCm39) intron probably benign
R4911:Gse1 UTSW 8 121,295,205 (GRCm39) intron probably benign
R5640:Gse1 UTSW 8 121,289,416 (GRCm39) missense possibly damaging 0.65
R5782:Gse1 UTSW 8 121,293,260 (GRCm39) missense probably damaging 1.00
R5980:Gse1 UTSW 8 120,956,376 (GRCm39) intron probably benign
R6090:Gse1 UTSW 8 121,297,908 (GRCm39) intron probably benign
R6156:Gse1 UTSW 8 121,215,866 (GRCm39) missense possibly damaging 0.95
R6191:Gse1 UTSW 8 121,280,542 (GRCm39) critical splice donor site probably null
R6270:Gse1 UTSW 8 121,295,902 (GRCm39) intron probably benign
R6502:Gse1 UTSW 8 121,280,428 (GRCm39) splice site probably null
R6573:Gse1 UTSW 8 121,294,536 (GRCm39) missense probably damaging 1.00
R6885:Gse1 UTSW 8 120,956,221 (GRCm39) intron probably benign
R6901:Gse1 UTSW 8 120,956,561 (GRCm39) intron probably benign
R6959:Gse1 UTSW 8 121,297,710 (GRCm39) intron probably benign
R7023:Gse1 UTSW 8 120,957,387 (GRCm39) intron probably benign
R7210:Gse1 UTSW 8 120,957,441 (GRCm39) missense unknown
R7263:Gse1 UTSW 8 121,300,910 (GRCm39) missense unknown
R7449:Gse1 UTSW 8 120,956,450 (GRCm39) missense unknown
R7602:Gse1 UTSW 8 121,296,043 (GRCm39) missense unknown
R7627:Gse1 UTSW 8 121,299,516 (GRCm39) missense unknown
R7635:Gse1 UTSW 8 121,299,634 (GRCm39) missense unknown
R7689:Gse1 UTSW 8 121,295,217 (GRCm39) missense unknown
R8108:Gse1 UTSW 8 120,956,549 (GRCm39) missense unknown
R8326:Gse1 UTSW 8 121,305,319 (GRCm39) missense unknown
R8474:Gse1 UTSW 8 121,295,123 (GRCm39) intron probably benign
R8544:Gse1 UTSW 8 121,280,391 (GRCm39) missense probably damaging 1.00
R8783:Gse1 UTSW 8 121,303,117 (GRCm39) missense unknown
R8817:Gse1 UTSW 8 121,294,542 (GRCm39) missense probably damaging 1.00
R8886:Gse1 UTSW 8 121,297,470 (GRCm39) missense unknown
R8896:Gse1 UTSW 8 121,303,185 (GRCm39) missense unknown
R9044:Gse1 UTSW 8 120,957,269 (GRCm39) missense unknown
R9130:Gse1 UTSW 8 121,295,052 (GRCm39) missense unknown
R9185:Gse1 UTSW 8 121,294,908 (GRCm39) missense possibly damaging 0.95
R9398:Gse1 UTSW 8 121,303,074 (GRCm39) missense unknown
R9430:Gse1 UTSW 8 121,299,049 (GRCm39) missense unknown
R9471:Gse1 UTSW 8 121,301,845 (GRCm39) missense unknown
R9696:Gse1 UTSW 8 120,956,280 (GRCm39) missense unknown
R9797:Gse1 UTSW 8 121,215,864 (GRCm39) missense probably damaging 0.99
X0026:Gse1 UTSW 8 121,294,902 (GRCm39) nonsense probably null
Z1177:Gse1 UTSW 8 120,956,591 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TACACAGTGTGAAGCTGACGG -3'
(R):5'- GTGCCAGAGTAGAGTGTGAC -3'

Sequencing Primer
(F):5'- ACGGTGGTGGCTTCACACTC -3'
(R):5'- AGGCCAACTCTGCAGCTC -3'
Posted On 2015-02-19