Mutagenetix > Incidental Mutation

Incidental Mutation 'R3616:Ap2b1'

268406

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

040673-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83324565 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 112 (C112S)

Ref Sequence

ENSEMBL: ENSMUSP00000134779 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]

AlphaFold

Q9DBG3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018875
AA Change: C112S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: C112S

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065692
AA Change: C112S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: C112S

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176430
AA Change: C112S

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: C112S

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176523

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176944
AA Change: C112S

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152
AA Change: C112S

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	199	3.4e-67	PFAM
Pfam:DNA_alkylation	18	196	4.6e-8	PFAM
Pfam:HEAT_2	88	185	3.1e-13	PFAM
Pfam:Cnd1	99	198	4.2e-27	PFAM
Pfam:HEAT	122	151	1.4e-5	PFAM

Meta Mutation Damage Score

0.1822

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (29/29)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Kif1b	A	T	4: 149,262,283		probably benign	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pard6b	T	C	2: 168,087,339		probably benign	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCAGGCTCTCGAGTAGAC -3'
(R):5'- TGAGATCCCGCAGAGAATCC -3'

Sequencing Primer
(F):5'- GAATGCCATGAGAGATTGGATTCTC -3'
(R):5'- GAGAATCCAGAAATCCCTGATCTTC -3'

Posted On

2015-02-19