Incidental Mutation 'R3616:Ap2b1'
ID 268406
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Name adaptor-related protein complex 2, beta 1 subunit
Synonyms 1300012O03Rik
MMRRC Submission 040673-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3616 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 83189850-83295861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 83215391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 112 (C112S)
Ref Sequence ENSEMBL: ENSMUSP00000134779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]
AlphaFold Q9DBG3
Predicted Effect possibly damaging
Transcript: ENSMUST00000018875
AA Change: C112S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: C112S

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065692
AA Change: C112S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: C112S

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132178
Predicted Effect possibly damaging
Transcript: ENSMUST00000176430
AA Change: C112S

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: C112S

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176523
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176944
AA Change: C112S

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152
AA Change: C112S

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 199 3.4e-67 PFAM
Pfam:DNA_alkylation 18 196 4.6e-8 PFAM
Pfam:HEAT_2 88 185 3.1e-13 PFAM
Pfam:Cnd1 99 198 4.2e-27 PFAM
Pfam:HEAT 122 151 1.4e-5 PFAM
Meta Mutation Damage Score 0.1822 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Kif1b A T 4: 149,346,740 (GRCm39) probably benign Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pard6b T C 2: 167,929,259 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Smr2 AT ATT 5: 88,256,683 (GRCm39) probably null Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83,223,984 (GRCm39) missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83,215,437 (GRCm39) missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83,212,799 (GRCm39) missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83,226,356 (GRCm39) missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83,237,592 (GRCm39) missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83,227,625 (GRCm39) missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83,232,210 (GRCm39) missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83,258,852 (GRCm39) missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83,212,793 (GRCm39) missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83,258,700 (GRCm39) splice site probably benign
R1222:Ap2b1 UTSW 11 83,237,564 (GRCm39) missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83,223,935 (GRCm39) missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83,237,657 (GRCm39) missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83,215,430 (GRCm39) missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83,227,212 (GRCm39) missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83,241,944 (GRCm39) missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83,215,587 (GRCm39) splice site probably benign
R3615:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83,281,542 (GRCm39) missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83,233,429 (GRCm39) missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83,226,430 (GRCm39) critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83,215,476 (GRCm39) missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83,288,605 (GRCm39) missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83,223,837 (GRCm39) nonsense probably null
R4916:Ap2b1 UTSW 11 83,281,532 (GRCm39) missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83,230,218 (GRCm39) missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83,233,427 (GRCm39) missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83,227,563 (GRCm39) splice site probably null
R5738:Ap2b1 UTSW 11 83,227,256 (GRCm39) splice site probably null
R6023:Ap2b1 UTSW 11 83,226,224 (GRCm39) missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83,237,499 (GRCm39) missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83,237,651 (GRCm39) missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83,199,065 (GRCm39) start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83,233,505 (GRCm39) missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83,226,317 (GRCm39) missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83,280,552 (GRCm39) missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83,223,948 (GRCm39) missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83,241,931 (GRCm39) missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83,258,824 (GRCm39) missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83,215,348 (GRCm39) missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83,280,554 (GRCm39) missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83,230,256 (GRCm39) critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83,258,733 (GRCm39) nonsense probably null
R8468:Ap2b1 UTSW 11 83,241,891 (GRCm39) missense probably damaging 1.00
R8943:Ap2b1 UTSW 11 83,237,579 (GRCm39) missense probably damaging 1.00
R9093:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
R9621:Ap2b1 UTSW 11 83,293,424 (GRCm39) missense probably damaging 1.00
X0064:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83,256,579 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCAGGCTCTCGAGTAGAC -3'
(R):5'- TGAGATCCCGCAGAGAATCC -3'

Sequencing Primer
(F):5'- GAATGCCATGAGAGATTGGATTCTC -3'
(R):5'- GAGAATCCAGAAATCCCTGATCTTC -3'
Posted On 2015-02-19