Mutagenetix > Incidental Mutation

Incidental Mutation 'R3616:Efs'

268410

Institutional Source

Beutler Lab

Gene Symbol

Efs

Ensembl Gene

ENSMUSG00000022203

Gene Name

embryonal Fyn-associated substrate

Synonyms

MMRRC Submission

040673-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R3616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54916535-54926126 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54920095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 160 (Y160C)

Ref Sequence

ENSEMBL: ENSMUSP00000154657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000227037] [ENSMUST00000227587]

AlphaFold

Q64355

Predicted Effect

probably damaging
Transcript: ENSMUST00000022813
AA Change: Y253C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: Y253C

Domain	Start	End	E-Value	Type
SH3	8	67	5.15e-19	SMART
low complexity region	201	215	N/A	INTRINSIC
low complexity region	255	273	N/A	INTRINSIC
low complexity region	305	325	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC
Pfam:DUF3513	370	555	9.2e-53	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000227037
AA Change: Y160C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000227587

Meta Mutation Damage Score

0.3969

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (29/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Kif1b	A	T	4: 149,262,283		probably benign	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pard6b	T	C	2: 168,087,339		probably benign	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Efs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02176:Efs	APN	14	54921042	missense	probably damaging	1.00
IGL02720:Efs	APN	14	54919715	missense	probably damaging	1.00
IGL02752:Efs	APN	14	54917423	missense	probably damaging	0.96
R0129:Efs	UTSW	14	54917223	missense	probably damaging	1.00
R1522:Efs	UTSW	14	54919715	missense	probably damaging	1.00
R1927:Efs	UTSW	14	54917163	missense	possibly damaging	0.89
R2327:Efs	UTSW	14	54917504	missense	probably benign	0.01
R3431:Efs	UTSW	14	54920224	missense	probably damaging	1.00
R3432:Efs	UTSW	14	54920224	missense	probably damaging	1.00
R3615:Efs	UTSW	14	54920095	missense	probably damaging	1.00
R3756:Efs	UTSW	14	54920422	splice site	probably benign
R3945:Efs	UTSW	14	54920651	splice site	probably benign
R4448:Efs	UTSW	14	54920192	missense	probably damaging	1.00
R4717:Efs	UTSW	14	54920344	missense	probably damaging	0.99
R4819:Efs	UTSW	14	54917153	missense	probably damaging	0.98
R5656:Efs	UTSW	14	54917127	missense	probably damaging	1.00
R5946:Efs	UTSW	14	54919494	splice site	probably null
R6054:Efs	UTSW	14	54921157	missense	probably damaging	1.00
R7457:Efs	UTSW	14	54919994	missense	probably benign
R7822:Efs	UTSW	14	54917450	missense	probably benign	0.09
R7970:Efs	UTSW	14	54920503	critical splice donor site	probably null
R8166:Efs	UTSW	14	54920620	missense	probably damaging	1.00
R8347:Efs	UTSW	14	54919784	missense	probably benign	0.28
R8896:Efs	UTSW	14	54920299	missense	possibly damaging	0.80
R9438:Efs	UTSW	14	54919411	missense
R9703:Efs	UTSW	14	54919414	missense	possibly damaging	0.88
X0028:Efs	UTSW	14	54920621	nonsense	probably null
Z1176:Efs	UTSW	14	54920336	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGATCATTGGCTACCTCCC -3'
(R):5'- TGATGTGCCTCCCAACATCC -3'

Sequencing Primer
(F):5'- GTTTGAGGCCCCCATAACCAG -3'
(R):5'- GAGGATGAAGCGCCCTAC -3'

Posted On

2015-02-19