Incidental Mutation 'R3616:Dpysl2'
ID268411
Institutional Source Beutler Lab
Gene Symbol Dpysl2
Ensembl Gene ENSMUSG00000022048
Gene Namedihydropyrimidinase-like 2
SynonymsDRP2, Crmp2, Ulip2, TOAD-64
MMRRC Submission 040673-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R3616 (G1)
Quality Score199
Status Validated
Chromosome14
Chromosomal Location66802864-66868688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66834370 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 107 (H107L)
Ref Sequence ENSEMBL: ENSMUSP00000022629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022629]
Predicted Effect probably damaging
Transcript: ENSMUST00000022629
AA Change: H107L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022629
Gene: ENSMUSG00000022048
AA Change: H107L

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.3e-54 PFAM
Meta Mutation Damage Score 0.2247 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collapsin response mediator protein family. Collapsin response mediator proteins form homo- and hetero-tetramers and facilitate neuron guidance, growth and polarity. The encoded protein promotes microtubule assembly and is required for Sema3A-mediated growth cone collapse, and also plays a role in synaptic signaling through interactions with calcium channels. This gene has been implicated in multiple neurological disorders, and hyperphosphorylation of the encoded protein may play a key role in the development of Alzheimer's disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal dendritic patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Gm597 T C 1: 28,776,575 D792G probably benign Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Kif1b A T 4: 149,262,283 probably benign Het
Krt25 A C 11: 99,317,298 V368G possibly damaging Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp10 A G 7: 108,924,476 F599S probably benign Het
Nlrp12 T A 7: 3,240,575 M436L probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pard6b T C 2: 168,087,339 probably benign Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss21 A G 17: 23,872,831 T258A probably benign Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Wdr20 A G 12: 110,793,939 T420A probably benign Het
Other mutations in Dpysl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Dpysl2 APN 14 66834232 missense probably damaging 1.00
IGL01451:Dpysl2 APN 14 66807918 missense possibly damaging 0.64
IGL02080:Dpysl2 APN 14 66829945 missense probably benign 0.01
IGL02313:Dpysl2 APN 14 66824390 missense probably benign 0.01
IGL02530:Dpysl2 APN 14 66824398 missense probably damaging 1.00
IGL03082:Dpysl2 APN 14 66808010 missense probably damaging 1.00
IGL03357:Dpysl2 APN 14 66813287 missense probably damaging 0.97
R0491:Dpysl2 UTSW 14 66807962 missense probably damaging 1.00
R0564:Dpysl2 UTSW 14 66805446 splice site probably benign
R1121:Dpysl2 UTSW 14 66862552 missense probably benign 0.13
R1190:Dpysl2 UTSW 14 66824401 missense probably benign 0.17
R1595:Dpysl2 UTSW 14 66815503 missense probably damaging 1.00
R1786:Dpysl2 UTSW 14 66862665 splice site probably benign
R1830:Dpysl2 UTSW 14 66868391 unclassified probably benign
R2076:Dpysl2 UTSW 14 66865122 missense probably damaging 1.00
R3615:Dpysl2 UTSW 14 66834370 missense probably damaging 1.00
R3928:Dpysl2 UTSW 14 66824431 missense possibly damaging 0.71
R4209:Dpysl2 UTSW 14 66815477 missense probably damaging 0.98
R4211:Dpysl2 UTSW 14 66815477 missense probably damaging 0.98
R4793:Dpysl2 UTSW 14 66815049 missense possibly damaging 0.93
R4859:Dpysl2 UTSW 14 66829439 missense probably damaging 1.00
R5640:Dpysl2 UTSW 14 66834368 missense probably benign 0.43
R5708:Dpysl2 UTSW 14 66813146 missense probably benign 0.07
R5808:Dpysl2 UTSW 14 66865172 critical splice acceptor site probably null
R7045:Dpysl2 UTSW 14 66829946 missense probably benign 0.06
R7140:Dpysl2 UTSW 14 66862533 missense probably benign 0.00
R7211:Dpysl2 UTSW 14 66829976 missense probably damaging 0.99
R7316:Dpysl2 UTSW 14 66862595 missense possibly damaging 0.94
R7361:Dpysl2 UTSW 14 66834215 missense possibly damaging 0.95
R7772:Dpysl2 UTSW 14 66828976 intron probably null
R7852:Dpysl2 UTSW 14 66862643 missense probably benign 0.07
Z1177:Dpysl2 UTSW 14 66862490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGCGAGACCTACCGTG -3'
(R):5'- CGGATCTGAGTCGTTCATGC -3'

Sequencing Primer
(F):5'- GGTCCTTCACCAGAGCTTC -3'
(R):5'- GGCTAGTCCAGTGCCAAGTTTC -3'
Posted On2015-02-19