Mutagenetix > Incidental Mutation

Incidental Mutation 'R3616:Espl1'

268412

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

040673-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102312989 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 944 (I944V)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I944V

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230120

Meta Mutation Damage Score

0.1426

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (29/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Kif1b	A	T	4: 149,262,283		probably benign	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pard6b	T	C	2: 168,087,339		probably benign	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGCTGCTTGGAATGTTAG -3'
(R):5'- ACAGACATCAATGTGGAGCCAC -3'

Sequencing Primer
(F):5'- GGAAAGAGCTCTGTGTTCAATTAG -3'
(R):5'- TGGAGCCACAGTCGGATTCAC -3'

Posted On

2015-02-19