Mutagenetix > Incidental Mutation

Incidental Mutation 'R3616:Dzip3'

268413

Institutional Source

Beutler Lab

Gene Symbol

Dzip3

Ensembl Gene

ENSMUSG00000064061

Gene Name

DAZ interacting protein 3, zinc finger

Synonyms

2A-HUB, 6430549P11Rik, 2310047C04Rik

MMRRC Submission

040673-MU

Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3616 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48924232-48994165 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 48937063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 869 (L869S)

Ref Sequence

ENSEMBL: ENSMUSP00000113344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000114516
AA Change: L663S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: L663S

Domain	Start	End	E-Value	Type
low complexity region	451	472	N/A	INTRINSIC
coiled coil region	548	568	N/A	INTRINSIC
coiled coil region	599	650	N/A	INTRINSIC
low complexity region	743	754	N/A	INTRINSIC
low complexity region	883	891	N/A	INTRINSIC
RING	938	977	2.09e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121869
AA Change: L869S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: L869S

Domain	Start	End	E-Value	Type
low complexity region	657	678	N/A	INTRINSIC
coiled coil region	754	774	N/A	INTRINSIC
coiled coil region	805	856	N/A	INTRINSIC
low complexity region	949	960	N/A	INTRINSIC
low complexity region	1089	1097	N/A	INTRINSIC
RING	1144	1183	2.09e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139350

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147358

Meta Mutation Damage Score

0.2307

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (29/29)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Kif1b	A	T	4: 149,262,283		probably benign	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pard6b	T	C	2: 168,087,339		probably benign	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Smr2	AT	ATT	5: 88,108,824		probably null	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Dzip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Dzip3	APN	16	48928415	missense	probably damaging	1.00
IGL00931:Dzip3	APN	16	48935497	critical splice donor site	probably null
IGL01109:Dzip3	APN	16	48929674	missense	probably benign	0.27
IGL01121:Dzip3	APN	16	48944881	missense	probably benign	0.10
IGL01328:Dzip3	APN	16	48972258	missense	probably damaging	1.00
IGL01729:Dzip3	APN	16	48928363	missense	possibly damaging	0.78
IGL02044:Dzip3	APN	16	48948427	missense	possibly damaging	0.90
IGL02051:Dzip3	APN	16	48972254	missense	probably benign	0.01
IGL02115:Dzip3	APN	16	48948485	missense	probably benign	0.00
IGL02125:Dzip3	APN	16	48927596	missense	probably damaging	1.00
IGL02136:Dzip3	APN	16	48927582	missense	possibly damaging	0.94
IGL02244:Dzip3	APN	16	48980988	missense	probably benign	0.01
IGL02253:Dzip3	APN	16	48944924	missense	probably benign	0.34
IGL02412:Dzip3	APN	16	48958457	missense	probably benign	0.00
IGL02452:Dzip3	APN	16	48938537	splice site	probably benign
IGL02481:Dzip3	APN	16	48975551	splice site	probably benign
IGL02499:Dzip3	APN	16	48933850	missense	probably damaging	1.00
IGL02511:Dzip3	APN	16	48936980	missense	possibly damaging	0.75
IGL02519:Dzip3	APN	16	48928396	missense	probably damaging	1.00
IGL02610:Dzip3	APN	16	48951653	missense	probably damaging	1.00
IGL03129:Dzip3	APN	16	48942083	missense	possibly damaging	0.51
IGL03342:Dzip3	APN	16	48929623	missense	probably damaging	0.98
IGL03493:Dzip3	APN	16	48951696	missense	probably benign	0.32
corvette	UTSW	16	48927540	critical splice donor site	probably null
dazwick	UTSW	16	48958465	missense	possibly damaging	0.90
1mM(1):Dzip3	UTSW	16	48951557	missense	probably damaging	1.00
PIT4651001:Dzip3	UTSW	16	48944878	missense	probably benign
R0313:Dzip3	UTSW	16	48937061	missense	probably damaging	0.99
R0483:Dzip3	UTSW	16	48947713	missense	possibly damaging	0.94
R0504:Dzip3	UTSW	16	48959643	splice site	probably benign
R0744:Dzip3	UTSW	16	48959675	missense	probably damaging	1.00
R0800:Dzip3	UTSW	16	48953808	splice site	probably benign
R0927:Dzip3	UTSW	16	48975477	missense	probably damaging	0.99
R0931:Dzip3	UTSW	16	48951558	missense	probably damaging	1.00
R1170:Dzip3	UTSW	16	48961208	missense	probably damaging	1.00
R1203:Dzip3	UTSW	16	48951817	missense	probably damaging	1.00
R1205:Dzip3	UTSW	16	48951681	missense	probably damaging	1.00
R1442:Dzip3	UTSW	16	48945622	missense	probably benign	0.19
R1526:Dzip3	UTSW	16	48937006	missense	probably damaging	1.00
R1560:Dzip3	UTSW	16	48951540	splice site	probably null
R1585:Dzip3	UTSW	16	48977878	splice site	probably benign
R1682:Dzip3	UTSW	16	48958417	critical splice donor site	probably null
R1957:Dzip3	UTSW	16	48927593	missense	probably damaging	1.00
R2472:Dzip3	UTSW	16	48953787	missense	possibly damaging	0.85
R2571:Dzip3	UTSW	16	48972218	splice site	probably null
R3040:Dzip3	UTSW	16	48928324	missense	probably damaging	1.00
R3081:Dzip3	UTSW	16	48927558	missense	probably damaging	1.00
R3615:Dzip3	UTSW	16	48937063	missense	probably damaging	1.00
R3786:Dzip3	UTSW	16	48975543	missense	probably benign	0.08
R3851:Dzip3	UTSW	16	48950013	missense	possibly damaging	0.94
R4097:Dzip3	UTSW	16	48958489	nonsense	probably null
R4371:Dzip3	UTSW	16	48943455	critical splice donor site	probably null
R4612:Dzip3	UTSW	16	48952040	nonsense	probably null
R4671:Dzip3	UTSW	16	48979590	nonsense	probably null
R4695:Dzip3	UTSW	16	48951561	missense	probably damaging	1.00
R4696:Dzip3	UTSW	16	48925969	unclassified	probably benign
R4769:Dzip3	UTSW	16	48938474	missense	probably damaging	0.97
R5063:Dzip3	UTSW	16	48953754	nonsense	probably null
R5321:Dzip3	UTSW	16	48957675	missense	possibly damaging	0.95
R5764:Dzip3	UTSW	16	48927361	intron	probably benign
R6020:Dzip3	UTSW	16	48951842	missense	probably damaging	1.00
R6218:Dzip3	UTSW	16	48958465	missense	possibly damaging	0.90
R6300:Dzip3	UTSW	16	48951807	missense	probably damaging	1.00
R6365:Dzip3	UTSW	16	48931273	missense	probably damaging	0.96
R6778:Dzip3	UTSW	16	48982083	missense	probably benign	0.00
R6915:Dzip3	UTSW	16	48942125	missense	possibly damaging	0.72
R7047:Dzip3	UTSW	16	48982126	missense	probably benign	0.04
R7059:Dzip3	UTSW	16	48980942	missense	probably benign	0.34
R7095:Dzip3	UTSW	16	48927790	missense	probably benign
R7227:Dzip3	UTSW	16	48951569	missense	probably damaging	0.99
R7319:Dzip3	UTSW	16	48927540	critical splice donor site	probably null
R7436:Dzip3	UTSW	16	48951989	missense	probably damaging	1.00
R7469:Dzip3	UTSW	16	48944879	missense	probably benign
R7526:Dzip3	UTSW	16	48975474	missense	probably damaging	0.99
R7964:Dzip3	UTSW	16	48951905	missense	probably damaging	1.00
R8131:Dzip3	UTSW	16	48933793	critical splice donor site	probably null
R8188:Dzip3	UTSW	16	48952136	missense	probably damaging	1.00
R8209:Dzip3	UTSW	16	48977944	missense	probably damaging	1.00
R8750:Dzip3	UTSW	16	48980975	missense	probably damaging	0.99
R8758:Dzip3	UTSW	16	48977937	missense	probably damaging	1.00
R8784:Dzip3	UTSW	16	48931265	missense	probably damaging	0.99
R9086:Dzip3	UTSW	16	48961130	missense	possibly damaging	0.81
R9157:Dzip3	UTSW	16	48927761	missense	probably benign
R9170:Dzip3	UTSW	16	48952038	missense	possibly damaging	0.74
R9762:Dzip3	UTSW	16	48928344	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAAAATCCATCACAGTCAACCGTGG -3'
(R):5'- CGATGTTCTTAGCCTTACTAGCAC -3'

Sequencing Primer
(F):5'- AACCGTGGAGATGCTTGTACCTC -3'
(R):5'- GCCTTACTAGCACTGTAACTATTG -3'

Posted On

2015-02-19