Incidental Mutation 'R3615:Gm597'
ID268414
Institutional Source Beutler Lab
Gene Symbol Gm597
Ensembl Gene ENSMUSG00000048411
Gene Namepredicted gene 597
SynonymsLOC210962
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3615 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location28776117-28780252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28776575 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 792 (D792G)
Ref Sequence ENSEMBL: ENSMUSP00000058140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059937]
Predicted Effect probably benign
Transcript: ENSMUST00000059937
AA Change: D792G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: D792G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 112 129 N/A INTRINSIC
Pfam:FAM75 137 472 8.1e-14 PFAM
low complexity region 664 675 N/A INTRINSIC
internal_repeat_1 718 807 1.4e-5 PROSPERO
internal_repeat_1 807 894 1.4e-5 PROSPERO
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dpysl2 T A 14: 66,834,370 H107L probably damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Krt25 A C 11: 99,317,298 V368G possibly damaging Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp10 A G 7: 108,924,476 F599S probably benign Het
Nlrp12 T A 7: 3,240,575 M436L probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss21 A G 17: 23,872,831 T258A probably benign Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Wdr20 A G 12: 110,793,939 T420A probably benign Het
Other mutations in Gm597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Gm597 APN 1 28778651 missense possibly damaging 0.94
IGL00885:Gm597 APN 1 28776845 missense unknown
IGL01296:Gm597 APN 1 28777056 missense probably benign 0.23
IGL01476:Gm597 APN 1 28777453 missense probably benign 0.04
IGL02125:Gm597 APN 1 28776338 missense possibly damaging 0.91
IGL02410:Gm597 APN 1 28778631 missense probably benign 0.25
IGL02982:Gm597 APN 1 28778054 missense probably damaging 1.00
IGL03031:Gm597 APN 1 28778583 missense probably benign 0.03
IGL03267:Gm597 APN 1 28777121 missense probably damaging 1.00
R0294:Gm597 UTSW 1 28778663 missense probably benign 0.00
R0433:Gm597 UTSW 1 28777342 nonsense probably null
R0485:Gm597 UTSW 1 28778142 missense probably damaging 1.00
R0645:Gm597 UTSW 1 28776930 missense probably damaging 0.99
R0744:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R0836:Gm597 UTSW 1 28777821 missense possibly damaging 0.46
R1036:Gm597 UTSW 1 28777802 missense probably benign 0.01
R1302:Gm597 UTSW 1 28776340 missense probably benign 0.00
R1394:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1395:Gm597 UTSW 1 28776809 missense possibly damaging 0.61
R1514:Gm597 UTSW 1 28778748 missense possibly damaging 0.83
R1535:Gm597 UTSW 1 28777424 missense probably damaging 1.00
R2004:Gm597 UTSW 1 28777179 missense probably damaging 1.00
R2021:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R2022:Gm597 UTSW 1 28778153 missense probably damaging 0.98
R3115:Gm597 UTSW 1 28776329 missense possibly damaging 0.92
R3616:Gm597 UTSW 1 28776575 missense probably benign 0.26
R3862:Gm597 UTSW 1 28777641 missense probably damaging 0.98
R4067:Gm597 UTSW 1 28777631 missense probably damaging 0.98
R4119:Gm597 UTSW 1 28777973 missense probably damaging 0.99
R4415:Gm597 UTSW 1 28777133 missense probably benign 0.01
R5010:Gm597 UTSW 1 28777862 missense possibly damaging 0.52
R5109:Gm597 UTSW 1 28777555 missense possibly damaging 0.46
R5122:Gm597 UTSW 1 28780060 missense probably benign 0.00
R5533:Gm597 UTSW 1 28778082 missense probably damaging 1.00
R6085:Gm597 UTSW 1 28778227 missense possibly damaging 0.55
R6116:Gm597 UTSW 1 28778699 missense probably benign 0.01
R6750:Gm597 UTSW 1 28777414 missense probably damaging 0.98
R6757:Gm597 UTSW 1 28780110 missense probably damaging 0.98
R6774:Gm597 UTSW 1 28776893 missense probably benign 0.00
R7156:Gm597 UTSW 1 28776767 missense possibly damaging 0.53
R7365:Gm597 UTSW 1 28780152 missense probably benign 0.04
R7739:Gm597 UTSW 1 28777608 missense possibly damaging 0.72
R7996:Gm597 UTSW 1 28778406 missense probably damaging 0.98
R8082:Gm597 UTSW 1 28777498 missense probably benign 0.08
R8281:Gm597 UTSW 1 28778144 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GGGAATCATTAGTGGACCACGG -3'
(R):5'- TGAGGAGCACAGTCAACATTTC -3'

Sequencing Primer
(F):5'- ATTAGTGGACCACGGCCCAC -3'
(R):5'- GGAGCACAGTCAACATTTCAAGTAC -3'
Posted On2015-02-19