Mutagenetix > Incidental Mutation

Incidental Mutation 'R3615:Dclk2'

268419

Institutional Source

Beutler Lab

Gene Symbol

Dclk2

Ensembl Gene

ENSMUSG00000028078

Gene Name

doublecortin-like kinase 2

Synonyms

Dcamkl2, Click-II, 6330415M09Rik

Accession Numbers

Genbank: NM_027539; MGI: 1918012

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3615 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86786151-86920852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 86920035 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 46 (P46S)

Ref Sequence

ENSEMBL: ENSMUSP00000142267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029719] [ENSMUST00000191752] [ENSMUST00000192773] [ENSMUST00000193632] [ENSMUST00000194452] [ENSMUST00000195561]

AlphaFold

Q6PGN3

Predicted Effect

probably damaging
Transcript: ENSMUST00000029719
AA Change: P46S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078
AA Change: P46S

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	393	650	4.96e-101	SMART
low complexity region	718	740	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000191752
AA Change: P46S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078
AA Change: P46S

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	393	646	2.4e-76	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000192773
AA Change: P46S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078
AA Change: P46S

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	1.1e-44	SMART
DCX	191	279	9.9e-37	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	392	641	8.6e-81	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000193632
AA Change: P46S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078
AA Change: P46S

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	1.1e-44	SMART
DCX	191	279	9.9e-37	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	339	362	N/A	INTRINSIC
S_TKc	409	666	2.4e-103	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194452
AA Change: P46S

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000141816
Gene: ENSMUSG00000028078
AA Change: P46S

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
Pfam:Pkinase_Tyr	392	590	2.2e-31	PFAM
Pfam:Pkinase	392	591	4.7e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000195561
AA Change: P46S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078
AA Change: P46S

Domain	Start	End	E-Value	Type
low complexity region	18	43	N/A	INTRINSIC
DCX	67	158	2.29e-42	SMART
DCX	191	279	2.17e-34	SMART
low complexity region	291	317	N/A	INTRINSIC
low complexity region	323	346	N/A	INTRINSIC
S_TKc	392	649	4.96e-101	SMART
low complexity region	717	739	N/A	INTRINSIC

Meta Mutation Damage Score

0.1082

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. This gene and the DCX gene, another family member, share function in the establishment of hippocampal organization and their absence results in a severe epileptic phenotype and lethality, as described in human patients with lissencephaly. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]

Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Dclk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dclk2	APN	3	86799090	critical splice acceptor site	probably null
IGL01769:Dclk2	APN	3	86816360	missense	possibly damaging	0.50
IGL01802:Dclk2	APN	3	86799027	missense	probably damaging	1.00
IGL02296:Dclk2	APN	3	86793293	missense	probably damaging	1.00
IGL02390:Dclk2	APN	3	86824683	missense	probably damaging	0.99
IGL02522:Dclk2	APN	3	86920116	missense	probably benign	0.01
IGL03104:Dclk2	APN	3	86836359	missense	probably damaging	1.00
IGL03337:Dclk2	APN	3	86906059	missense	probably damaging	1.00
R0219:Dclk2	UTSW	3	86813669	splice site	probably benign
R0400:Dclk2	UTSW	3	86813747	splice site	probably null
R0606:Dclk2	UTSW	3	86906004	missense	probably damaging	1.00
R1537:Dclk2	UTSW	3	86806184	missense	probably damaging	0.97
R1569:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1571:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1612:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1680:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1689:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1714:Dclk2	UTSW	3	86906093	missense	probably benign	0.00
R1745:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1746:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R1752:Dclk2	UTSW	3	86806127	missense	possibly damaging	0.61
R1829:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R2008:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R2125:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R2126:Dclk2	UTSW	3	86805639	missense	possibly damaging	0.50
R2132:Dclk2	UTSW	3	86920046	missense	probably benign	0.44
R2314:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R2338:Dclk2	UTSW	3	86799017	missense	probably damaging	1.00
R2849:Dclk2	UTSW	3	86793223	missense	probably damaging	1.00
R3108:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R3109:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R3616:Dclk2	UTSW	3	86920035	missense	probably damaging	1.00
R4051:Dclk2	UTSW	3	86830822	critical splice donor site	probably null
R4052:Dclk2	UTSW	3	86830822	critical splice donor site	probably null
R4208:Dclk2	UTSW	3	86830822	critical splice donor site	probably null
R4643:Dclk2	UTSW	3	86806180	missense	possibly damaging	0.93
R4654:Dclk2	UTSW	3	86836376	missense	probably damaging	1.00
R4693:Dclk2	UTSW	3	86815093	missense	possibly damaging	0.67
R4716:Dclk2	UTSW	3	86919881	missense	probably damaging	1.00
R4914:Dclk2	UTSW	3	86824742	splice site	probably null
R4915:Dclk2	UTSW	3	86824742	splice site	probably null
R4917:Dclk2	UTSW	3	86824742	splice site	probably null
R5218:Dclk2	UTSW	3	86805678	missense	probably damaging	1.00
R5510:Dclk2	UTSW	3	86906037	missense	possibly damaging	0.93
R5520:Dclk2	UTSW	3	86919840	missense	probably damaging	1.00
R5867:Dclk2	UTSW	3	86791859	makesense	probably null
R5976:Dclk2	UTSW	3	86787225	missense	possibly damaging	0.53
R6048:Dclk2	UTSW	3	86905965	missense	probably damaging	1.00
R6111:Dclk2	UTSW	3	86805661	missense	probably benign	0.28
R6192:Dclk2	UTSW	3	86815150	missense	probably damaging	1.00
R6289:Dclk2	UTSW	3	86831817	missense	probably benign	0.18
R6595:Dclk2	UTSW	3	86792067	critical splice donor site	probably benign
R6897:Dclk2	UTSW	3	86831763	missense	probably benign	0.00
R7061:Dclk2	UTSW	3	86831731	critical splice donor site	probably null
R7095:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R7096:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R7208:Dclk2	UTSW	3	86799602	splice site	probably null
R7253:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R7256:Dclk2	UTSW	3	86793259	missense	probably damaging	1.00
R8003:Dclk2	UTSW	3	86793301	critical splice acceptor site	probably null
R8061:Dclk2	UTSW	3	86813674	splice site	probably benign
R8927:Dclk2	UTSW	3	86831741	missense	probably damaging	1.00
R8928:Dclk2	UTSW	3	86831741	missense	probably damaging	1.00
R8964:Dclk2	UTSW	3	86836391	missense	probably damaging	1.00
R9704:Dclk2	UTSW	3	86920080	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- ATTGTCAGACAGTGAGCGG -3'
(R):5'- TGTCCCGCTGCTTTAAGACG -3'

Sequencing Primer
(F):5'- AGCGGGTGAGCTCTATGAG -3'
(R):5'- ACGGAGCGCCTAGATCG -3'

Posted On

2015-02-19