Incidental Mutation 'R3615:Spata31g1'
ID 268420
Institutional Source Beutler Lab
Gene Symbol Spata31g1
Ensembl Gene ENSMUSG00000028451
Gene Name SPATA31 subfamily G member 1
Synonyms 1700022I11Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R3615 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 42969946-42974325 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42971864 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 399 (N399S)
Ref Sequence ENSEMBL: ENSMUSP00000030163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030163] [ENSMUST00000139127] [ENSMUST00000185904] [ENSMUST00000190902]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030163
AA Change: N399S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030163
Gene: ENSMUSG00000028451
AA Change: N399S

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
internal_repeat_1 322 432 6.53e-5 PROSPERO
low complexity region 434 449 N/A INTRINSIC
low complexity region 507 521 N/A INTRINSIC
low complexity region 599 610 N/A INTRINSIC
internal_repeat_1 622 738 6.53e-5 PROSPERO
low complexity region 847 861 N/A INTRINSIC
low complexity region 897 908 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 944 958 N/A INTRINSIC
low complexity region 990 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139127
SMART Domains Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185904
SMART Domains Protein: ENSMUSP00000140492
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:FAM75 99 149 2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189414
Predicted Effect probably benign
Transcript: ENSMUST00000190902
SMART Domains Protein: ENSMUSP00000140363
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Spata31g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Spata31g1 APN 4 42,973,982 (GRCm39) missense probably benign 0.40
IGL01340:Spata31g1 APN 4 42,971,984 (GRCm39) missense possibly damaging 0.94
IGL02078:Spata31g1 APN 4 42,972,685 (GRCm39) missense possibly damaging 0.71
IGL02082:Spata31g1 APN 4 42,970,198 (GRCm39) missense probably benign 0.00
IGL02993:Spata31g1 APN 4 42,971,719 (GRCm39) missense probably damaging 0.99
IGL03174:Spata31g1 APN 4 42,970,975 (GRCm39) missense probably benign 0.00
IGL03188:Spata31g1 APN 4 42,971,225 (GRCm39) missense possibly damaging 0.56
R0031:Spata31g1 UTSW 4 42,973,712 (GRCm39) missense probably damaging 0.99
R0179:Spata31g1 UTSW 4 42,972,214 (GRCm39) missense probably benign 0.00
R0409:Spata31g1 UTSW 4 42,972,203 (GRCm39) missense probably damaging 0.98
R0422:Spata31g1 UTSW 4 42,972,199 (GRCm39) missense possibly damaging 0.95
R0462:Spata31g1 UTSW 4 42,973,429 (GRCm39) missense probably benign
R0467:Spata31g1 UTSW 4 42,972,715 (GRCm39) missense probably benign
R0677:Spata31g1 UTSW 4 42,970,952 (GRCm39) nonsense probably null
R0723:Spata31g1 UTSW 4 42,971,691 (GRCm39) missense probably damaging 0.98
R1479:Spata31g1 UTSW 4 42,972,543 (GRCm39) missense possibly damaging 0.55
R1586:Spata31g1 UTSW 4 42,971,512 (GRCm39) missense probably benign 0.03
R1956:Spata31g1 UTSW 4 42,970,105 (GRCm39) splice site probably null
R2030:Spata31g1 UTSW 4 42,974,131 (GRCm39) nonsense probably null
R2074:Spata31g1 UTSW 4 42,974,171 (GRCm39) missense probably benign 0.38
R2162:Spata31g1 UTSW 4 42,972,238 (GRCm39) missense possibly damaging 0.59
R2419:Spata31g1 UTSW 4 42,974,146 (GRCm39) missense possibly damaging 0.94
R2939:Spata31g1 UTSW 4 42,972,946 (GRCm39) missense probably benign 0.04
R3616:Spata31g1 UTSW 4 42,971,864 (GRCm39) missense probably benign 0.10
R3981:Spata31g1 UTSW 4 42,971,534 (GRCm39) missense probably damaging 0.99
R5037:Spata31g1 UTSW 4 42,972,195 (GRCm39) missense probably benign
R5252:Spata31g1 UTSW 4 42,971,706 (GRCm39) missense probably benign 0.00
R5526:Spata31g1 UTSW 4 42,972,125 (GRCm39) missense possibly damaging 0.90
R5642:Spata31g1 UTSW 4 42,971,831 (GRCm39) missense possibly damaging 0.61
R5935:Spata31g1 UTSW 4 42,971,465 (GRCm39) missense probably benign
R6082:Spata31g1 UTSW 4 42,972,511 (GRCm39) missense probably benign 0.27
R6136:Spata31g1 UTSW 4 42,972,853 (GRCm39) missense probably damaging 0.96
R6361:Spata31g1 UTSW 4 42,972,695 (GRCm39) missense probably benign 0.05
R6494:Spata31g1 UTSW 4 42,971,924 (GRCm39) missense possibly damaging 0.94
R6641:Spata31g1 UTSW 4 42,971,245 (GRCm39) missense possibly damaging 0.90
R7289:Spata31g1 UTSW 4 42,973,252 (GRCm39) missense possibly damaging 0.66
R7289:Spata31g1 UTSW 4 42,972,379 (GRCm39) missense probably benign 0.00
R7777:Spata31g1 UTSW 4 42,971,095 (GRCm39) missense probably benign
R7777:Spata31g1 UTSW 4 42,970,171 (GRCm39) nonsense probably null
R7893:Spata31g1 UTSW 4 42,971,539 (GRCm39) missense probably damaging 0.99
R8066:Spata31g1 UTSW 4 42,971,929 (GRCm39) missense possibly damaging 0.66
R8311:Spata31g1 UTSW 4 42,973,169 (GRCm39) missense probably benign 0.19
R8706:Spata31g1 UTSW 4 42,971,776 (GRCm39) missense probably benign 0.02
R8743:Spata31g1 UTSW 4 42,971,030 (GRCm39) missense probably benign 0.00
R8774:Spata31g1 UTSW 4 42,971,087 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Spata31g1 UTSW 4 42,971,087 (GRCm39) missense probably damaging 1.00
R8806:Spata31g1 UTSW 4 42,971,261 (GRCm39) missense probably benign 0.37
R8916:Spata31g1 UTSW 4 42,973,034 (GRCm39) missense probably damaging 1.00
R8927:Spata31g1 UTSW 4 42,972,251 (GRCm39) missense probably benign 0.00
R8928:Spata31g1 UTSW 4 42,972,251 (GRCm39) missense probably benign 0.00
R8947:Spata31g1 UTSW 4 42,972,097 (GRCm39) missense probably benign 0.17
R9193:Spata31g1 UTSW 4 42,971,519 (GRCm39) missense probably benign 0.01
R9569:Spata31g1 UTSW 4 42,971,740 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AATCCAGAATTGCCTTTTGCC -3'
(R):5'- TGACAGGAAGCTGGCATTAG -3'

Sequencing Primer
(F):5'- AGAATTGCCTTTTGCCTTTCTGTTG -3'
(R):5'- TATATGCTAGGATGCCCCACTGAG -3'
Posted On 2015-02-19