Incidental Mutation 'R3615:Angptl3'
ID 268421
Institutional Source Beutler Lab
Gene Symbol Angptl3
Ensembl Gene ENSMUSG00000028553
Gene Name angiopoietin-like 3
Synonyms hypl
Accession Numbers
Essential gene? Probably non essential (E-score: 0.213) question?
Stock # R3615 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 98919191-98926429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 98922702 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 248 (A248T)
Ref Sequence ENSEMBL: ENSMUSP00000030280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030280] [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
AlphaFold Q9R182
Predicted Effect probably benign
Transcript: ENSMUST00000030280
AA Change: A248T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030280
Gene: ENSMUSG00000028553
AA Change: A248T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
Blast:FBG 195 240 6e-8 BLAST
FBG 241 454 1.5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125546
Predicted Effect probably benign
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136091
Predicted Effect probably benign
Transcript: ENSMUST00000205650
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a member of the angiopoietin-like family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may inhibit triglyceride metabolism. Homozygous knockout mice for this gene exhibit reduced plasma lipid concentrations, including reduced plasma triglyceride concentrations, and enhanced activity of enzymes involved in triglyceride metabolism. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene display decreased plasma cholesterol and triglyceride levels. A spontaneous mutation results in a similar phenotype except that there is also a reduction in fat pad weight and decreased free fatty acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Angptl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Angptl3 APN 4 98,923,077 (GRCm39) missense probably damaging 0.99
IGL01859:Angptl3 APN 4 98,925,669 (GRCm39) nonsense probably null
IGL02126:Angptl3 APN 4 98,919,738 (GRCm39) critical splice donor site probably null
IGL02134:Angptl3 APN 4 98,919,349 (GRCm39) missense probably damaging 1.00
IGL02573:Angptl3 APN 4 98,926,171 (GRCm39) missense probably damaging 1.00
IGL02756:Angptl3 APN 4 98,919,399 (GRCm39) missense probably damaging 1.00
IGL03369:Angptl3 APN 4 98,923,057 (GRCm39) intron probably benign
R0309:Angptl3 UTSW 4 98,922,706 (GRCm39) missense probably benign 0.32
R0549:Angptl3 UTSW 4 98,919,692 (GRCm39) missense probably benign 0.00
R0675:Angptl3 UTSW 4 98,921,499 (GRCm39) missense probably benign 0.02
R1465:Angptl3 UTSW 4 98,925,757 (GRCm39) missense probably benign 0.01
R1465:Angptl3 UTSW 4 98,925,757 (GRCm39) missense probably benign 0.01
R1738:Angptl3 UTSW 4 98,921,499 (GRCm39) missense probably benign 0.02
R2007:Angptl3 UTSW 4 98,925,634 (GRCm39) missense probably damaging 0.99
R2656:Angptl3 UTSW 4 98,926,201 (GRCm39) missense probably benign 0.01
R3436:Angptl3 UTSW 4 98,921,540 (GRCm39) missense probably benign 0.24
R3437:Angptl3 UTSW 4 98,921,540 (GRCm39) missense probably benign 0.24
R3616:Angptl3 UTSW 4 98,922,702 (GRCm39) missense probably benign 0.06
R4161:Angptl3 UTSW 4 98,919,728 (GRCm39) missense probably damaging 0.99
R4534:Angptl3 UTSW 4 98,926,232 (GRCm39) missense possibly damaging 0.73
R4615:Angptl3 UTSW 4 98,919,598 (GRCm39) missense probably benign 0.03
R4835:Angptl3 UTSW 4 98,925,649 (GRCm39) missense probably benign 0.36
R5308:Angptl3 UTSW 4 98,922,723 (GRCm39) missense probably benign 0.33
R5413:Angptl3 UTSW 4 98,919,259 (GRCm39) missense probably benign 0.12
R5668:Angptl3 UTSW 4 98,920,321 (GRCm39) critical splice acceptor site probably null
R5906:Angptl3 UTSW 4 98,925,804 (GRCm39) missense probably benign 0.07
R6520:Angptl3 UTSW 4 98,926,085 (GRCm39) missense probably benign 0.35
R6544:Angptl3 UTSW 4 98,919,675 (GRCm39) missense probably damaging 1.00
R6762:Angptl3 UTSW 4 98,925,654 (GRCm39) missense possibly damaging 0.91
R7889:Angptl3 UTSW 4 98,919,308 (GRCm39) missense probably benign 0.00
R8305:Angptl3 UTSW 4 98,919,548 (GRCm39) missense probably damaging 1.00
R8690:Angptl3 UTSW 4 98,925,759 (GRCm39) missense probably benign 0.00
R9284:Angptl3 UTSW 4 98,919,480 (GRCm39) missense probably benign 0.00
Z1088:Angptl3 UTSW 4 98,922,757 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACTCTCACAAGATAGCGC -3'
(R):5'- CCCAGATTTGCGTGAATAACC -3'

Sequencing Primer
(F):5'- TCACAAGATAGCGCTTTTTAAAATTC -3'
(R):5'- CCATTTTCTGTGAGTTGATAACAGGC -3'
Posted On 2015-02-19