Incidental Mutation 'R3615:Ptprf'
ID 268422
Institutional Source Beutler Lab
Gene Symbol Ptprf
Ensembl Gene ENSMUSG00000033295
Gene Name protein tyrosine phosphatase receptor type F
Synonyms RPTP-LAR, LAR
Accession Numbers
Essential gene? Possibly essential (E-score: 0.657) question?
Stock # R3615 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118065410-118148602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118095080 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 275 (A275T)
Ref Sequence ENSEMBL: ENSMUSP00000152568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049074] [ENSMUST00000222620]
AlphaFold A2A8L5
Predicted Effect probably benign
Transcript: ENSMUST00000049074
AA Change: A269T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039368
Gene: ENSMUSG00000033295
AA Change: A269T

DomainStartEndE-ValueType
IGc2 45 114 2.64e-12 SMART
IGc2 147 214 1.48e-15 SMART
IG 238 316 1.06e-11 SMART
FN3 319 398 6.9e-14 SMART
FN3 414 497 5.73e-11 SMART
FN3 512 591 4.06e-11 SMART
FN3 606 693 8.69e-11 SMART
FN3 709 797 8.83e-12 SMART
FN3 812 892 3.2e-9 SMART
FN3 907 988 2.53e-12 SMART
FN3 1003 1079 3.48e-1 SMART
coiled coil region 1146 1175 N/A INTRINSIC
transmembrane domain 1253 1275 N/A INTRINSIC
PTPc 1342 1600 1.12e-138 SMART
PTPc 1629 1891 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124758
SMART Domains Protein: ENSMUSP00000119954
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
FN3 37 116 4.06e-11 SMART
FN3 132 220 8.83e-12 SMART
FN3 235 315 3.2e-9 SMART
FN3 330 411 2.53e-12 SMART
FN3 426 502 3.48e-1 SMART
coiled coil region 568 597 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
PTPc 776 1034 1.12e-138 SMART
PTPc 1063 1325 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150096
SMART Domains Protein: ENSMUSP00000117313
Gene: ENSMUSG00000033295

DomainStartEndE-ValueType
FN3 14 66 2.7e1 SMART
FN3 82 165 5.73e-11 SMART
FN3 180 259 4.06e-11 SMART
FN3 275 372 6.69e-12 SMART
FN3 385 461 2.83e-1 SMART
coiled coil region 527 556 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
PTPc 735 993 1.12e-138 SMART
PTPc 1022 1284 3.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222620
AA Change: A275T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains three Ig-like domains, and nine non-Ig like domains similar to that of neural-cell adhesion molecule. This PTP was shown to function in the regulation of epithelial cell-cell contacts at adherents junctions, as well as in the control of beta-catenin signaling. An increased expression level of this protein was found in the insulin-responsive tissue of obese, insulin-resistant individuals, and may contribute to the pathogenesis of insulin resistance. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females have premature involution of the mammary glands leading to an inability to feed pups. Other characteristics of null mice include defective nerve regeneration and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Ptprf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ptprf APN 4 118,080,417 (GRCm39) splice site probably benign
IGL01337:Ptprf APN 4 118,093,488 (GRCm39) missense probably damaging 1.00
IGL01482:Ptprf APN 4 118,069,651 (GRCm39) missense probably damaging 1.00
IGL01743:Ptprf APN 4 118,106,095 (GRCm39) critical splice donor site probably null
IGL01987:Ptprf APN 4 118,134,567 (GRCm39) missense probably benign
IGL02189:Ptprf APN 4 118,070,839 (GRCm39) splice site probably benign
IGL03067:Ptprf APN 4 118,067,910 (GRCm39) missense possibly damaging 0.67
PIT4677001:Ptprf UTSW 4 118,070,809 (GRCm39) missense probably damaging 1.00
R0382:Ptprf UTSW 4 118,080,591 (GRCm39) splice site probably benign
R0788:Ptprf UTSW 4 118,083,663 (GRCm39) missense probably damaging 0.97
R1164:Ptprf UTSW 4 118,114,689 (GRCm39) missense probably damaging 1.00
R1478:Ptprf UTSW 4 118,069,302 (GRCm39) nonsense probably null
R1483:Ptprf UTSW 4 118,093,161 (GRCm39) missense possibly damaging 0.81
R1611:Ptprf UTSW 4 118,093,430 (GRCm39) missense probably benign 0.34
R1721:Ptprf UTSW 4 118,082,096 (GRCm39) missense possibly damaging 0.56
R1817:Ptprf UTSW 4 118,080,462 (GRCm39) missense probably benign 0.02
R1818:Ptprf UTSW 4 118,067,068 (GRCm39) missense probably damaging 1.00
R1860:Ptprf UTSW 4 118,081,129 (GRCm39) missense probably damaging 1.00
R2208:Ptprf UTSW 4 118,126,369 (GRCm39) splice site probably benign
R2406:Ptprf UTSW 4 118,126,501 (GRCm39) missense possibly damaging 0.62
R2912:Ptprf UTSW 4 118,106,177 (GRCm39) missense probably damaging 0.98
R3111:Ptprf UTSW 4 118,068,629 (GRCm39) missense probably damaging 1.00
R3498:Ptprf UTSW 4 118,082,127 (GRCm39) missense probably damaging 0.99
R3499:Ptprf UTSW 4 118,082,127 (GRCm39) missense probably damaging 0.99
R3616:Ptprf UTSW 4 118,095,080 (GRCm39) missense probably benign 0.04
R4038:Ptprf UTSW 4 118,114,805 (GRCm39) missense probably damaging 1.00
R4243:Ptprf UTSW 4 118,083,649 (GRCm39) critical splice donor site probably null
R4260:Ptprf UTSW 4 118,083,280 (GRCm39) missense possibly damaging 0.64
R4693:Ptprf UTSW 4 118,068,219 (GRCm39) missense probably benign 0.16
R4726:Ptprf UTSW 4 118,069,414 (GRCm39) missense possibly damaging 0.86
R4746:Ptprf UTSW 4 118,082,236 (GRCm39) missense possibly damaging 0.83
R4802:Ptprf UTSW 4 118,067,526 (GRCm39) intron probably benign
R4857:Ptprf UTSW 4 118,074,394 (GRCm39) splice site probably benign
R5071:Ptprf UTSW 4 118,069,196 (GRCm39) missense probably damaging 1.00
R5221:Ptprf UTSW 4 118,082,305 (GRCm39) missense probably benign 0.00
R5327:Ptprf UTSW 4 118,093,586 (GRCm39) missense probably damaging 1.00
R5336:Ptprf UTSW 4 118,092,831 (GRCm39) missense probably damaging 1.00
R5356:Ptprf UTSW 4 118,083,535 (GRCm39) missense probably benign 0.00
R5373:Ptprf UTSW 4 118,083,238 (GRCm39) missense possibly damaging 0.93
R5555:Ptprf UTSW 4 118,082,121 (GRCm39) missense probably damaging 1.00
R5693:Ptprf UTSW 4 118,093,374 (GRCm39) nonsense probably null
R5860:Ptprf UTSW 4 118,068,486 (GRCm39) intron probably benign
R5869:Ptprf UTSW 4 118,067,579 (GRCm39) missense probably damaging 1.00
R5890:Ptprf UTSW 4 118,081,932 (GRCm39) missense probably benign
R5932:Ptprf UTSW 4 118,068,964 (GRCm39) missense probably benign 0.10
R6028:Ptprf UTSW 4 118,070,826 (GRCm39) missense probably benign 0.01
R6030:Ptprf UTSW 4 118,068,245 (GRCm39) missense probably benign 0.19
R6030:Ptprf UTSW 4 118,068,245 (GRCm39) missense probably benign 0.19
R6088:Ptprf UTSW 4 118,067,952 (GRCm39) missense possibly damaging 0.68
R6089:Ptprf UTSW 4 118,068,281 (GRCm39) missense probably damaging 0.99
R6108:Ptprf UTSW 4 118,080,453 (GRCm39) missense probably benign 0.01
R6320:Ptprf UTSW 4 118,070,011 (GRCm39) missense probably benign
R6741:Ptprf UTSW 4 118,080,565 (GRCm39) missense probably benign 0.00
R6744:Ptprf UTSW 4 118,093,562 (GRCm39) missense probably benign 0.00
R6750:Ptprf UTSW 4 118,088,928 (GRCm39) missense probably benign 0.03
R6906:Ptprf UTSW 4 118,126,474 (GRCm39) missense possibly damaging 0.95
R7021:Ptprf UTSW 4 118,081,101 (GRCm39) missense probably benign 0.00
R7153:Ptprf UTSW 4 118,088,740 (GRCm39) missense probably damaging 1.00
R7326:Ptprf UTSW 4 118,088,866 (GRCm39) missense probably damaging 0.99
R7337:Ptprf UTSW 4 118,068,322 (GRCm39) missense probably damaging 0.99
R7374:Ptprf UTSW 4 118,114,689 (GRCm39) missense probably damaging 1.00
R7375:Ptprf UTSW 4 118,070,011 (GRCm39) missense probably benign
R7399:Ptprf UTSW 4 118,083,720 (GRCm39) missense probably benign 0.28
R7417:Ptprf UTSW 4 118,069,369 (GRCm39) missense probably damaging 1.00
R7448:Ptprf UTSW 4 118,092,864 (GRCm39) missense probably benign 0.03
R7530:Ptprf UTSW 4 118,069,945 (GRCm39) missense probably damaging 1.00
R7593:Ptprf UTSW 4 118,069,593 (GRCm39) missense probably benign 0.00
R8172:Ptprf UTSW 4 118,068,275 (GRCm39) missense probably benign 0.03
R8239:Ptprf UTSW 4 118,069,309 (GRCm39) missense possibly damaging 0.88
R8257:Ptprf UTSW 4 118,083,476 (GRCm39) missense probably damaging 0.96
R8331:Ptprf UTSW 4 118,083,263 (GRCm39) missense probably benign 0.27
R8441:Ptprf UTSW 4 118,075,255 (GRCm39) splice site probably benign
R8681:Ptprf UTSW 4 118,088,844 (GRCm39) missense probably benign 0.02
R8771:Ptprf UTSW 4 118,068,987 (GRCm39) missense possibly damaging 0.95
R8815:Ptprf UTSW 4 118,095,125 (GRCm39) missense possibly damaging 0.52
R8998:Ptprf UTSW 4 118,083,671 (GRCm39) missense probably benign 0.00
R8999:Ptprf UTSW 4 118,083,671 (GRCm39) missense probably benign 0.00
R9389:Ptprf UTSW 4 118,093,236 (GRCm39) missense probably benign
R9508:Ptprf UTSW 4 118,126,776 (GRCm39) nonsense probably null
R9581:Ptprf UTSW 4 118,092,257 (GRCm39) missense probably benign 0.00
X0067:Ptprf UTSW 4 118,093,223 (GRCm39) missense possibly damaging 0.85
Z1177:Ptprf UTSW 4 118,126,812 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAGGATCTAAAGCCCAAGAC -3'
(R):5'- AGAGGCTTCCTTGATGAGGG -3'

Sequencing Primer
(F):5'- CAGAGGAGAACATCAGCTAGCTG -3'
(R):5'- TTCCTTGATGAGGGGCCCC -3'
Posted On 2015-02-19