Mutagenetix > Incidental Mutations

Incidental Mutation 'R3615:A2ml1'

268428

Institutional Source

Beutler Lab

Gene Symbol

A2ml1

Ensembl Gene

ENSMUSG00000047228

Gene Name

alpha-2-macroglobulin like 1

Synonyms

Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3615 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128539821-128581608 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128558294 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 818 (T818A)

Ref Sequence

ENSEMBL: ENSMUSP00000059426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060574]

Predicted Effect

probably benign
Transcript: ENSMUST00000060574
AA Change: T818A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: T818A

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
Pfam:A2M_N	120	213	6.3e-17	PFAM
A2M_N_2	448	594	2.95e-37	SMART
A2M	736	826	2.11e-33	SMART
Pfam:Thiol-ester_cl	959	988	3.1e-17	PFAM
Pfam:A2M_comp	1008	1255	2.3e-71	PFAM
A2M_recep	1361	1447	1.22e-29	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203889

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

98% (40/41)

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in A2ml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:A2ml1	APN	6	128578156	missense	possibly damaging	0.78
IGL00596:A2ml1	APN	6	128570067	missense	probably damaging	0.99
IGL00912:A2ml1	APN	6	128552307	missense	probably benign	0.04
IGL01320:A2ml1	APN	6	128575588	missense	probably benign	0.00
IGL01470:A2ml1	APN	6	128580412	missense	probably damaging	0.96
IGL01576:A2ml1	APN	6	128554330	splice site	probably benign
IGL01761:A2ml1	APN	6	128546337	missense	possibly damaging	0.61
IGL01792:A2ml1	APN	6	128560679	missense	probably benign	0.04
IGL01843:A2ml1	APN	6	128553338	splice site	probably benign
IGL01946:A2ml1	APN	6	128570479	missense	possibly damaging	0.81
IGL02016:A2ml1	APN	6	128558335	missense	probably damaging	1.00
IGL02170:A2ml1	APN	6	128547210	missense	possibly damaging	0.58
IGL02269:A2ml1	APN	6	128553338	splice site	probably benign
IGL02589:A2ml1	APN	6	128581500	missense	probably benign	0.00
IGL02959:A2ml1	APN	6	128567060	missense	probably benign	0.04
IGL02970:A2ml1	APN	6	128569979	missense	probably damaging	1.00
IGL03206:A2ml1	APN	6	128553276	missense	possibly damaging	0.50
IGL03298:A2ml1	APN	6	128543960	missense	probably benign	0.00
1mM(1):A2ml1	UTSW	6	128580960	missense	probably benign	0.02
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0128:A2ml1	UTSW	6	128575639	splice site	probably benign
R0299:A2ml1	UTSW	6	128553232	splice site	probably benign
R0523:A2ml1	UTSW	6	128558326	missense	possibly damaging	0.92
R0565:A2ml1	UTSW	6	128568743	nonsense	probably null
R0599:A2ml1	UTSW	6	128552245	missense	probably damaging	1.00
R0626:A2ml1	UTSW	6	128550773	missense	probably damaging	0.99
R0732:A2ml1	UTSW	6	128546448	missense	probably damaging	1.00
R0880:A2ml1	UTSW	6	128560646	missense	possibly damaging	0.49
R1070:A2ml1	UTSW	6	128543300	missense	probably damaging	1.00
R1166:A2ml1	UTSW	6	128570917	missense	probably benign	0.00
R1278:A2ml1	UTSW	6	128558507	missense	probably damaging	1.00
R1421:A2ml1	UTSW	6	128543960	missense	probably benign	0.00
R1536:A2ml1	UTSW	6	128547233	nonsense	probably null
R1786:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R1808:A2ml1	UTSW	6	128543299	missense	probably damaging	1.00
R1813:A2ml1	UTSW	6	128566273	missense	probably benign	0.34
R1863:A2ml1	UTSW	6	128550783	missense	probably damaging	0.99
R2007:A2ml1	UTSW	6	128542892	missense	probably benign	0.13
R2062:A2ml1	UTSW	6	128552308	missense	probably benign	0.08
R2127:A2ml1	UTSW	6	128558437	missense	probably damaging	1.00
R2130:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2131:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2201:A2ml1	UTSW	6	128547305	missense	probably null	0.34
R2319:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2321:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2322:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2369:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2370:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2371:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2372:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2375:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2893:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2894:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3438:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3616:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3773:A2ml1	UTSW	6	128555083	missense	probably benign	0.02
R3785:A2ml1	UTSW	6	128544924	critical splice donor site	probably null
R3803:A2ml1	UTSW	6	128545070	missense	probably benign	0.17
R3824:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R3878:A2ml1	UTSW	6	128554361	missense	probably benign	0.05
R4176:A2ml1	UTSW	6	128545037	missense	possibly damaging	0.68
R4229:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4230:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4348:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4351:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4352:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4353:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4427:A2ml1	UTSW	6	128545046	missense	probably benign	0.00
R4971:A2ml1	UTSW	6	128547227	missense	probably damaging	0.98
R5014:A2ml1	UTSW	6	128543933	missense	probably benign	0.00
R5369:A2ml1	UTSW	6	128568833	missense	probably damaging	0.97
R5532:A2ml1	UTSW	6	128553330	critical splice acceptor site	probably null
R5860:A2ml1	UTSW	6	128541061	missense	probably benign	0.15
R5872:A2ml1	UTSW	6	128561526	missense	probably damaging	1.00
R5926:A2ml1	UTSW	6	128560645	missense	probably benign
R5977:A2ml1	UTSW	6	128581122	missense	probably damaging	1.00
R5980:A2ml1	UTSW	6	128567055	missense	possibly damaging	0.82
R6014:A2ml1	UTSW	6	128571985	missense	probably damaging	1.00
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6061:A2ml1	UTSW	6	128568712	missense	probably damaging	1.00
R6327:A2ml1	UTSW	6	128558692	splice site	probably null
R6331:A2ml1	UTSW	6	128552236	missense	probably damaging	0.96
R6465:A2ml1	UTSW	6	128541078	missense	probably damaging	1.00
R6640:A2ml1	UTSW	6	128553285	missense	probably benign	0.41
R6792:A2ml1	UTSW	6	128546329	nonsense	probably null
R6793:A2ml1	UTSW	6	128546329	nonsense	probably null
R7207:A2ml1	UTSW	6	128550771	missense	probably benign	0.04
R7378:A2ml1	UTSW	6	128546247	critical splice donor site	probably null
R7556:A2ml1	UTSW	6	128569964	missense	probably damaging	1.00
R8010:A2ml1	UTSW	6	128580340	missense	probably benign	0.08
R8017:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8019:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8035:A2ml1	UTSW	6	128553280	missense	probably damaging	0.99
R8094:A2ml1	UTSW	6	128572082	missense	probably damaging	1.00
R8144:A2ml1	UTSW	6	128569999	missense	possibly damaging	0.84
R8365:A2ml1	UTSW	6	128580955	nonsense	probably null
R8382:A2ml1	UTSW	6	128560682	missense	probably benign	0.01
R8388:A2ml1	UTSW	6	128571974	missense	probably benign	0.03
R8717:A2ml1	UTSW	6	128566995	missense	probably benign	0.00
RF014:A2ml1	UTSW	6	128570068	missense	probably damaging	0.96
X0063:A2ml1	UTSW	6	128572012	missense	probably benign
Z1176:A2ml1	UTSW	6	128571977	missense	probably benign	0.09
Z1177:A2ml1	UTSW	6	128545076	missense	probably benign
Z1177:A2ml1	UTSW	6	128561616	nonsense	probably null
Z1177:A2ml1	UTSW	6	128575607	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- CAGCAGAATGGGCATCATCAC -3'
(R):5'- TCCCTGATACCATCACCCAGTG -3'

Sequencing Primer
(F):5'- GTTCACTCAGCAGTTAAGAGCACTG -3'
(R):5'- CCAGTGGGAGGCCAGCG -3'

Posted On

2015-02-19