Incidental Mutation 'R3615:Nlrp12'
ID 268430
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene Name NLR family, pyrin domain containing 12
Synonyms Nalp12
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R3615 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 3267458-3298370 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3289205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 436 (M436L)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
AlphaFold E9Q5R7
Predicted Effect probably benign
Transcript: ENSMUST00000108653
AA Change: M436L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: M436L

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205233
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3,289,387 (GRCm39) missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3,288,722 (GRCm39) missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3,289,316 (GRCm39) missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3,283,790 (GRCm39) missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3,288,463 (GRCm39) missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3,282,574 (GRCm39) missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3,298,175 (GRCm39) utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3,289,094 (GRCm39) missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3,289,597 (GRCm39) missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3,293,980 (GRCm39) missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3,288,722 (GRCm39) missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3,290,063 (GRCm39) missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3,289,037 (GRCm39) missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3,289,037 (GRCm39) missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3,288,664 (GRCm39) missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3,282,659 (GRCm39) missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3,298,007 (GRCm39) missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3,297,892 (GRCm39) missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3,277,166 (GRCm39) missense probably benign
R1680:Nlrp12 UTSW 7 3,289,804 (GRCm39) missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3,277,049 (GRCm39) missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3,281,825 (GRCm39) missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3,290,079 (GRCm39) missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3,282,575 (GRCm39) missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3,289,205 (GRCm39) missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3,289,576 (GRCm39) missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3,289,576 (GRCm39) missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3,288,554 (GRCm39) missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3,279,693 (GRCm39) missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3,289,072 (GRCm39) missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3,289,613 (GRCm39) missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3,289,613 (GRCm39) missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3,290,003 (GRCm39) missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3,298,015 (GRCm39) missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3,273,926 (GRCm39) missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3,267,933 (GRCm39) utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3,290,002 (GRCm39) missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3,290,002 (GRCm39) missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3,288,518 (GRCm39) missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3,282,673 (GRCm39) missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3,290,039 (GRCm39) missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3,289,313 (GRCm39) missense probably benign 0.03
R6957:Nlrp12 UTSW 7 3,271,160 (GRCm39) missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3,288,481 (GRCm39) missense probably benign
R7340:Nlrp12 UTSW 7 3,281,755 (GRCm39) missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3,297,887 (GRCm39) missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3,289,831 (GRCm39) missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3,289,977 (GRCm39) missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3,271,213 (GRCm39) missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3,277,020 (GRCm39) critical splice donor site probably null
R7793:Nlrp12 UTSW 7 3,294,030 (GRCm39) missense probably benign
R8257:Nlrp12 UTSW 7 3,297,962 (GRCm39) missense probably damaging 1.00
R8357:Nlrp12 UTSW 7 3,289,435 (GRCm39) missense probably damaging 1.00
R8457:Nlrp12 UTSW 7 3,289,435 (GRCm39) missense probably damaging 1.00
R8558:Nlrp12 UTSW 7 3,298,111 (GRCm39) missense probably damaging 1.00
R8826:Nlrp12 UTSW 7 3,289,621 (GRCm39) missense possibly damaging 0.79
R9480:Nlrp12 UTSW 7 3,288,993 (GRCm39) nonsense probably null
X0064:Nlrp12 UTSW 7 3,290,016 (GRCm39) missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3,289,205 (GRCm39) missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3,271,211 (GRCm39) missense probably benign 0.00
Z1176:Nlrp12 UTSW 7 3,271,211 (GRCm39) missense probably benign 0.00
Z1177:Nlrp12 UTSW 7 3,271,211 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACGTTGAGGAAAGTGGACAC -3'
(R):5'- TCTCCGAGGAAGCTAGGAAG -3'

Sequencing Primer
(F):5'- AGTGGACACATCTGCTCCATCTAG -3'
(R):5'- TCTACAGATATTTCCACAACACTGG -3'
Posted On 2015-02-19