Incidental Mutation 'R3615:Vrk2'
ID 268438
Institutional Source Beutler Lab
Gene Symbol Vrk2
Ensembl Gene ENSMUSG00000064090
Gene Name vaccinia related kinase 2
Synonyms 2810003O05Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R3615 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 26421398-26544006 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26439866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 235 (I235T)
Ref Sequence ENSEMBL: ENSMUSP00000105130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078362] [ENSMUST00000109504]
AlphaFold Q8BN21
Predicted Effect possibly damaging
Transcript: ENSMUST00000078362
AA Change: I235T

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077471
Gene: ENSMUSG00000064090
AA Change: I235T

DomainStartEndE-ValueType
Pfam:Pkinase 29 298 4.4e-18 PFAM
Pfam:Pkinase_Tyr 29 313 2e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109504
AA Change: I235T

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105130
Gene: ENSMUSG00000064090
AA Change: I235T

DomainStartEndE-ValueType
Pfam:Pkinase 29 302 2.8e-22 PFAM
Pfam:Pkinase_Tyr 29 313 1.3e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Meta Mutation Damage Score 0.3032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Vrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Vrk2 APN 11 26,485,560 (GRCm39) missense possibly damaging 0.73
IGL02011:Vrk2 APN 11 26,421,717 (GRCm39) missense probably benign 0.10
IGL02185:Vrk2 APN 11 26,485,638 (GRCm39) nonsense probably null
IGL02257:Vrk2 APN 11 26,484,266 (GRCm39) missense probably damaging 1.00
IGL02424:Vrk2 APN 11 26,426,564 (GRCm39) missense probably benign 0.00
macromacro UTSW 11 26,499,325 (GRCm39) missense probably damaging 1.00
R0127:Vrk2 UTSW 11 26,484,313 (GRCm39) splice site probably benign
R0184:Vrk2 UTSW 11 26,500,046 (GRCm39) missense probably damaging 0.98
R0670:Vrk2 UTSW 11 26,436,959 (GRCm39) critical splice donor site probably null
R0751:Vrk2 UTSW 11 26,433,331 (GRCm39) splice site probably benign
R0766:Vrk2 UTSW 11 26,485,522 (GRCm39) splice site probably benign
R1103:Vrk2 UTSW 11 26,499,325 (GRCm39) missense probably damaging 1.00
R1184:Vrk2 UTSW 11 26,433,331 (GRCm39) splice site probably benign
R1312:Vrk2 UTSW 11 26,485,522 (GRCm39) splice site probably benign
R2041:Vrk2 UTSW 11 26,497,914 (GRCm39) missense probably benign 0.01
R2857:Vrk2 UTSW 11 26,433,324 (GRCm39) missense possibly damaging 0.54
R2859:Vrk2 UTSW 11 26,433,324 (GRCm39) missense possibly damaging 0.54
R3616:Vrk2 UTSW 11 26,439,866 (GRCm39) missense possibly damaging 0.90
R4163:Vrk2 UTSW 11 26,497,915 (GRCm39) missense probably benign 0.00
R4651:Vrk2 UTSW 11 26,439,803 (GRCm39) missense probably damaging 0.98
R4652:Vrk2 UTSW 11 26,439,803 (GRCm39) missense probably damaging 0.98
R4662:Vrk2 UTSW 11 26,421,611 (GRCm39) missense possibly damaging 0.95
R5262:Vrk2 UTSW 11 26,541,697 (GRCm39) missense possibly damaging 0.94
R5458:Vrk2 UTSW 11 26,448,919 (GRCm39) missense probably damaging 0.99
R5529:Vrk2 UTSW 11 26,449,036 (GRCm39) missense probably damaging 1.00
R5840:Vrk2 UTSW 11 26,484,314 (GRCm39) splice site probably benign
R5892:Vrk2 UTSW 11 26,484,372 (GRCm39) intron probably benign
R6054:Vrk2 UTSW 11 26,436,975 (GRCm39) missense probably benign 0.20
R6923:Vrk2 UTSW 11 26,439,893 (GRCm39) missense probably damaging 1.00
R6952:Vrk2 UTSW 11 26,485,597 (GRCm39) missense probably damaging 0.97
R7841:Vrk2 UTSW 11 26,421,457 (GRCm39) missense probably damaging 1.00
R8165:Vrk2 UTSW 11 26,485,575 (GRCm39) missense probably benign 0.21
R9074:Vrk2 UTSW 11 26,543,917 (GRCm39) intron probably benign
R9583:Vrk2 UTSW 11 26,433,157 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTTCACTGGTGCCAAGGG -3'
(R):5'- ACCCTTACTTCAGCAGCCAG -3'

Sequencing Primer
(F):5'- CAAGGGGCCATTCTCTCTG -3'
(R):5'- CAGTCGCTGCCTGTCTGTG -3'
Posted On 2015-02-19