Incidental Mutation 'R3615:Krt25'
ID268440
Institutional Source Beutler Lab
Gene Symbol Krt25
Ensembl Gene ENSMUSG00000035831
Gene Namekeratin 25
Synonyms4631426H08Rik, mIRSa1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R3615 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99315516-99322951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 99317298 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 368 (V368G)
Ref Sequence ENSEMBL: ENSMUSP00000048439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038004]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038004
AA Change: V368G

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048439
Gene: ENSMUSG00000035831
AA Change: V368G

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
Filament 74 389 4.13e-146 SMART
low complexity region 391 403 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutations in this gene have a defect in hair formation resulting in a wavy coat and curly vibrissae. Some alleles may compromise normal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dpysl2 T A 14: 66,834,370 H107L probably damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Gm597 T C 1: 28,776,575 D792G probably benign Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp10 A G 7: 108,924,476 F599S probably benign Het
Nlrp12 T A 7: 3,240,575 M436L probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss21 A G 17: 23,872,831 T258A probably benign Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Wdr20 A G 12: 110,793,939 T420A probably benign Het
Other mutations in Krt25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Krt25 APN 11 99318170 missense probably benign 0.28
IGL02415:Krt25 APN 11 99322572 missense probably damaging 1.00
IGL02816:Krt25 APN 11 99318151 missense probably benign 0.10
Plush UTSW 11 99322635 missense probably damaging 1.00
Sinuous UTSW 11 99322630 missense probably damaging 0.99
R0138:Krt25 UTSW 11 99322698 missense probably benign 0.00
R0219:Krt25 UTSW 11 99318059 missense probably benign 0.01
R0932:Krt25 UTSW 11 99321283 missense possibly damaging 0.94
R1733:Krt25 UTSW 11 99316552 nonsense probably null
R1855:Krt25 UTSW 11 99318315 missense probably damaging 1.00
R2120:Krt25 UTSW 11 99321197 missense probably benign 0.01
R2504:Krt25 UTSW 11 99317296 nonsense probably null
R3616:Krt25 UTSW 11 99317298 missense possibly damaging 0.64
R4590:Krt25 UTSW 11 99318028 intron probably benign
R6250:Krt25 UTSW 11 99321163 missense probably damaging 1.00
R6331:Krt25 UTSW 11 99317427 missense probably damaging 1.00
R6927:Krt25 UTSW 11 99317379 missense probably damaging 1.00
R7067:Krt25 UTSW 11 99317383 missense probably benign 0.01
R7289:Krt25 UTSW 11 99321272 missense probably benign 0.15
R7360:Krt25 UTSW 11 99317406 missense probably benign 0.01
R8057:Krt25 UTSW 11 99317343 missense probably benign 0.44
R8090:Krt25 UTSW 11 99316590 critical splice acceptor site probably null
Z1176:Krt25 UTSW 11 99322822 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGCATTTGTTCCTGGTCACG -3'
(R):5'- GTTCCTCCTGACAGAAACACTCTC -3'

Sequencing Primer
(F):5'- GTCACGGATCTAATAGTTCAGCGC -3'
(R):5'- TCCTGACAGAAACACTCTCTGGAG -3'
Posted On2015-02-19