Mutagenetix > Incidental Mutation

Incidental Mutation 'R3615:Krt25'

268440

Institutional Source

Beutler Lab

Gene Symbol

Krt25

Ensembl Gene

ENSMUSG00000035831

Gene Name

keratin 25

Synonyms

4631426H08Rik, mIRSa1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R3615 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99315516-99322951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 99317298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 368 (V368G)

Ref Sequence

ENSEMBL: ENSMUSP00000048439 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038004]

AlphaFold

Q8VCW2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038004
AA Change: V368G

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000048439
Gene: ENSMUSG00000035831
AA Change: V368G

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
low complexity region	35	52	N/A	INTRINSIC
Filament	74	389	4.13e-146	SMART
low complexity region	391	403	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutations in this gene have a defect in hair formation resulting in a wavy coat and curly vibrissae. Some alleles may compromise normal growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Krt25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Krt25	APN	11	99318170	missense	probably benign	0.28
IGL02415:Krt25	APN	11	99322572	missense	probably damaging	1.00
IGL02816:Krt25	APN	11	99318151	missense	probably benign	0.10
Plush	UTSW	11	99322635	missense	probably damaging	1.00
Sinuous	UTSW	11	99322630	missense	probably damaging	0.99
R0138:Krt25	UTSW	11	99322698	missense	probably benign	0.00
R0219:Krt25	UTSW	11	99318059	missense	probably benign	0.01
R0932:Krt25	UTSW	11	99321283	missense	possibly damaging	0.94
R1733:Krt25	UTSW	11	99316552	nonsense	probably null
R1855:Krt25	UTSW	11	99318315	missense	probably damaging	1.00
R2120:Krt25	UTSW	11	99321197	missense	probably benign	0.01
R2504:Krt25	UTSW	11	99317296	nonsense	probably null
R3616:Krt25	UTSW	11	99317298	missense	possibly damaging	0.64
R4590:Krt25	UTSW	11	99318028	intron	probably benign
R6250:Krt25	UTSW	11	99321163	missense	probably damaging	1.00
R6331:Krt25	UTSW	11	99317427	missense	probably damaging	1.00
R6927:Krt25	UTSW	11	99317379	missense	probably damaging	1.00
R7067:Krt25	UTSW	11	99317383	missense	probably benign	0.01
R7289:Krt25	UTSW	11	99321272	missense	probably benign	0.15
R7360:Krt25	UTSW	11	99317406	missense	probably benign	0.01
R8057:Krt25	UTSW	11	99317343	missense	probably benign	0.44
R8090:Krt25	UTSW	11	99316590	critical splice acceptor site	probably null
R8933:Krt25	UTSW	11	99321238	missense	probably benign	0.31
R8995:Krt25	UTSW	11	99316556	missense	probably benign
R9040:Krt25	UTSW	11	99316553	missense	probably benign
Z1176:Krt25	UTSW	11	99322822	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TGCATTTGTTCCTGGTCACG -3'
(R):5'- GTTCCTCCTGACAGAAACACTCTC -3'

Sequencing Primer
(F):5'- GTCACGGATCTAATAGTTCAGCGC -3'
(R):5'- TCCTGACAGAAACACTCTCTGGAG -3'

Posted On

2015-02-19