Mutagenetix > Incidental Mutations

Incidental Mutation 'R3615:Usp36'

268441

Institutional Source

Beutler Lab

Gene Symbol

Usp36

Ensembl Gene

ENSMUSG00000033909

Gene Name

ubiquitin specific peptidase 36

Synonyms

2700002L06Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.887) question?

Stock #

R3615 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118259651-118290244 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 118276759 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000106296] [ENSMUST00000144153] [ENSMUST00000144153]

Predicted Effect

probably null
Transcript: ENSMUST00000092382

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000092382

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106296

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106296

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000144153

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000144153

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Meta Mutation Damage Score

0.9598

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,864	N399S	probably benign	Het
A2ml1	T	C	6: 128,558,294	T818A	probably benign	Het
Aasdh	A	G	5: 76,888,782	V304A	probably benign	Het
Angptl3	G	A	4: 99,034,465	A248T	probably benign	Het
Ap2b1	T	A	11: 83,324,565	C112S	possibly damaging	Het
Aqr	A	T	2: 114,136,887	I549N	probably damaging	Het
Barhl1	C	T	2: 28,911,550	D161N	possibly damaging	Het
Col28a1	A	G	6: 8,014,942	V821A	probably damaging	Het
Dclk2	G	A	3: 86,920,035	P46S	probably damaging	Het
Dnah1	A	G	14: 31,315,148	L247P	possibly damaging	Het
Dpysl2	T	A	14: 66,834,370	H107L	probably damaging	Het
Dzip3	A	G	16: 48,937,063	L869S	probably damaging	Het
Efs	T	C	14: 54,920,095	Y160C	probably damaging	Het
Enam	A	T	5: 88,504,447	N1197Y	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam184b	A	G	5: 45,582,815	V343A	possibly damaging	Het
Fbxw26	A	T	9: 109,743,760	Y105*	probably null	Het
Fiz1	A	G	7: 5,008,172	L449P	probably benign	Het
Foxi2	T	A	7: 135,410,451	C23S	possibly damaging	Het
Gdf2	G	A	14: 33,944,957	R212Q	probably damaging	Het
Gm5105	C	A	3: 138,049,688	A46S	unknown	Het
Gm597	T	C	1: 28,776,575	D792G	probably benign	Het
Grik5	C	T	7: 25,022,571	A581T	probably benign	Het
Gse1	C	G	8: 120,572,742		probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Krt25	A	C	11: 99,317,298	V368G	possibly damaging	Het
Lacc1	A	G	14: 77,033,287	V269A	probably benign	Het
Lamc1	T	C	1: 153,251,150	K417E	probably damaging	Het
Miip	A	G	4: 147,865,914	M75T	probably benign	Het
Nlrp10	A	G	7: 108,924,476	F599S	probably benign	Het
Nlrp12	T	A	7: 3,240,575	M436L	probably benign	Het
Olfr142	T	C	2: 90,252,409	E193G	possibly damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Pla2g2e	G	A	4: 138,880,374	V22I	probably benign	Het
Plekhd1	A	G	12: 80,717,270	E202G	probably damaging	Het
Prss21	A	G	17: 23,872,831	T258A	probably benign	Het
Prss34	A	G	17: 25,298,846	E65G	probably benign	Het
Psap	A	G	10: 60,294,603	N149S	probably benign	Het
Ptprf	C	T	4: 118,237,883	A275T	probably benign	Het
Sem1	A	G	6: 6,578,520	L12P	probably damaging	Het
Sf3b3	A	G	8: 110,844,523	Y4H	probably damaging	Het
Sh3bp4	G	T	1: 89,137,705	R7L	probably damaging	Het
Slc16a1	T	A	3: 104,653,570	L397Q	probably damaging	Het
Smg5	A	G	3: 88,336,451	S10G	possibly damaging	Het
Tas2r102	C	T	6: 132,762,818	Q230*	probably null	Het
Tdo2	A	G	3: 81,975,428	Y13H	possibly damaging	Het
Tmem231	C	T	8: 111,918,313	R187H	possibly damaging	Het
Tmem30b	A	G	12: 73,545,579	M254T	probably damaging	Het
Trpm1	G	A	7: 64,243,570	G1057R	probably damaging	Het
Tusc3	A	T	8: 39,164,838	K347N	probably damaging	Het
Vash2	T	C	1: 190,970,419	Y117C	probably damaging	Het
Vrk2	A	G	11: 26,489,866	I235T	possibly damaging	Het
Wdr20	A	G	12: 110,793,939	T420A	probably benign	Het

Other mutations in Usp36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Usp36	APN	11	118264820	missense	possibly damaging	0.76
IGL01115:Usp36	APN	11	118285960	missense	probably damaging	1.00
IGL01720:Usp36	APN	11	118275002	missense	probably damaging	0.99
IGL02410:Usp36	APN	11	118276185	missense	probably damaging	1.00
IGL02700:Usp36	APN	11	118276157	missense	possibly damaging	0.95
IGL02926:Usp36	APN	11	118264783	missense	probably benign	0.22
IGL03145:Usp36	APN	11	118279241	missense	probably damaging	1.00
IGL03203:Usp36	APN	11	118285810	missense	probably benign	0.42
IGL03265:Usp36	APN	11	118264809	missense	possibly damaging	0.65
R0482:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R0499:Usp36	UTSW	11	118273571	missense	probably damaging	0.98
R0606:Usp36	UTSW	11	118263028	splice site	probably benign
R0646:Usp36	UTSW	11	118273021	missense	probably damaging	1.00
R1579:Usp36	UTSW	11	118284945	missense	probably damaging	1.00
R1646:Usp36	UTSW	11	118273566	missense	probably damaging	1.00
R1716:Usp36	UTSW	11	118272131	critical splice donor site	probably null
R1886:Usp36	UTSW	11	118272958	missense	probably damaging	1.00
R2014:Usp36	UTSW	11	118262508	splice site	probably benign
R2068:Usp36	UTSW	11	118275018	missense	possibly damaging	0.80
R2146:Usp36	UTSW	11	118268665	missense	probably benign	0.02
R2191:Usp36	UTSW	11	118285023	missense	possibly damaging	0.95
R2899:Usp36	UTSW	11	118276756	splice site	probably benign
R3176:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3177:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3276:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3277:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3616:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3768:Usp36	UTSW	11	118263052	missense	probably damaging	1.00
R3899:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R3900:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R4484:Usp36	UTSW	11	118285795	missense	probably damaging	0.99
R4809:Usp36	UTSW	11	118263070	missense	probably damaging	1.00
R5135:Usp36	UTSW	11	118264905	missense	possibly damaging	0.58
R5323:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R6226:Usp36	UTSW	11	118277274	missense	probably damaging	1.00
R6266:Usp36	UTSW	11	118268585	missense	probably damaging	1.00
R7191:Usp36	UTSW	11	118268834	missense	probably benign	0.39
R7215:Usp36	UTSW	11	118265154	missense	possibly damaging	0.87
R7289:Usp36	UTSW	11	118273529	missense	probably damaging	1.00
R7535:Usp36	UTSW	11	118262046	missense	possibly damaging	0.92
R7675:Usp36	UTSW	11	118263696	missense	probably benign	0.11
R7843:Usp36	UTSW	11	118285965	missense	probably damaging	1.00
R7926:Usp36	UTSW	11	118285965	missense	probably damaging	1.00
R8228:Usp36	UTSW	11	118264890	missense	possibly damaging	0.77
X0020:Usp36	UTSW	11	118273613	missense	probably damaging	1.00
Z1177:Usp36	UTSW	11	118276200	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTTGCATAGGAGAACTGCAG -3'
(R):5'- TGATGACAGAACCTGGCCTC -3'

Sequencing Primer
(F):5'- GACAGATGCAAATGTTGGCCTGTC -3'
(R):5'- AGAACCTGGCCTCACCTGTATC -3'

Posted On

2015-02-19