Incidental Mutation 'R3615:Wdr20'
ID268444
Institutional Source Beutler Lab
Gene Symbol Wdr20
Ensembl Gene ENSMUSG00000037957
Gene NameWD repeat domain 20
SynonymsWdr20a, 2310040A13Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R3615 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110737944-110804238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110793939 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 420 (T420A)
Ref Sequence ENSEMBL: ENSMUSP00000093059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095410] [ENSMUST00000192870] [ENSMUST00000193053] [ENSMUST00000195886]
Predicted Effect probably benign
Transcript: ENSMUST00000095410
AA Change: T420A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093059
Gene: ENSMUSG00000037957
AA Change: T420A

DomainStartEndE-ValueType
WD40 140 178 2.66e0 SMART
WD40 209 248 4.95e-4 SMART
WD40 251 290 1.47e-6 SMART
WD40 293 382 8.59e-1 SMART
Blast:WD40 464 559 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000192870
SMART Domains Protein: ENSMUSP00000141887
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 89 131 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193053
SMART Domains Protein: ENSMUSP00000141678
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 89 131 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194118
Predicted Effect probably benign
Transcript: ENSMUST00000195886
SMART Domains Protein: ENSMUSP00000142157
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 29 71 1e-16 BLAST
Meta Mutation Damage Score 0.0615 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that functions to preserve and regulate the activity of the USP12-UAF1 deubiquitinating enzyme complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dpysl2 T A 14: 66,834,370 H107L probably damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Gm597 T C 1: 28,776,575 D792G probably benign Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Krt25 A C 11: 99,317,298 V368G possibly damaging Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp10 A G 7: 108,924,476 F599S probably benign Het
Nlrp12 T A 7: 3,240,575 M436L probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss21 A G 17: 23,872,831 T258A probably benign Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Other mutations in Wdr20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Wdr20 APN 12 110779449 nonsense probably null
IGL01663:Wdr20 APN 12 110793514 missense probably damaging 1.00
IGL02385:Wdr20 APN 12 110793223 missense probably benign
IGL02710:Wdr20 APN 12 110793110 splice site probably benign
IGL02993:Wdr20 APN 12 110794308 nonsense probably null
R1500:Wdr20 UTSW 12 110794030 missense probably benign
R1897:Wdr20 UTSW 12 110793723 missense probably benign
R2006:Wdr20 UTSW 12 110793568 missense probably damaging 1.00
R3616:Wdr20 UTSW 12 110793939 missense probably benign
R4023:Wdr20 UTSW 12 110793516 missense probably benign 0.01
R4026:Wdr20 UTSW 12 110793516 missense probably benign 0.01
R4157:Wdr20 UTSW 12 110738174 missense possibly damaging 0.68
R4868:Wdr20 UTSW 12 110738234 missense probably damaging 1.00
R6126:Wdr20 UTSW 12 110794102 missense probably benign
R6282:Wdr20 UTSW 12 110797009 unclassified probably benign
R6867:Wdr20 UTSW 12 110793699 missense probably benign
R7081:Wdr20 UTSW 12 110803450 missense possibly damaging 0.46
R7842:Wdr20 UTSW 12 110738215 missense probably benign 0.01
R7925:Wdr20 UTSW 12 110738215 missense probably benign 0.01
R8045:Wdr20 UTSW 12 110793319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCGCCCTGTAAGTGTTACG -3'
(R):5'- CACTGCTCTTGCTGGAAATG -3'

Sequencing Primer
(F):5'- CGCCCTGTAAGTGTTACGTATCG -3'
(R):5'- TGCTGGAAATGTGTCCCATAC -3'
Posted On2015-02-19