Incidental Mutation 'R3615:Dnah1'
ID 268445
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Name dynein, axonemal, heavy chain 1
Synonyms MDHC7, B230373P09Rik, ferf1, G1-415-19, E030034C22Rik, Dnahc1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3615 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 30982332-31045853 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31037105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 247 (L247P)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048603
AA Change: L247P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: L247P

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228755
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31,009,830 (GRCm39) missense probably benign 0.01
IGL00227:Dnah1 APN 14 31,008,853 (GRCm39) missense probably damaging 1.00
IGL00491:Dnah1 APN 14 30,983,796 (GRCm39) missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31,022,020 (GRCm39) missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31,022,766 (GRCm39) nonsense probably null
IGL00911:Dnah1 APN 14 31,026,391 (GRCm39) splice site probably null
IGL00949:Dnah1 APN 14 31,029,047 (GRCm39) missense probably benign 0.00
IGL00976:Dnah1 APN 14 31,000,095 (GRCm39) missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31,021,897 (GRCm39) missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31,014,277 (GRCm39) missense probably damaging 1.00
IGL01716:Dnah1 APN 14 30,985,335 (GRCm39) missense probably benign 0.34
IGL01893:Dnah1 APN 14 30,988,427 (GRCm39) missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31,032,872 (GRCm39) missense probably benign 0.40
IGL01938:Dnah1 APN 14 31,005,844 (GRCm39) missense probably benign
IGL02032:Dnah1 APN 14 30,996,326 (GRCm39) missense probably benign
IGL02052:Dnah1 APN 14 30,990,743 (GRCm39) missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31,026,958 (GRCm39) missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31,026,885 (GRCm39) missense probably benign 0.00
IGL02143:Dnah1 APN 14 31,005,246 (GRCm39) missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31,022,924 (GRCm39) missense probably benign 0.00
IGL02442:Dnah1 APN 14 31,009,835 (GRCm39) missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31,027,790 (GRCm39) missense probably benign 0.05
IGL02558:Dnah1 APN 14 30,996,336 (GRCm39) missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31,006,772 (GRCm39) missense probably benign 0.05
IGL02720:Dnah1 APN 14 30,984,177 (GRCm39) missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31,005,955 (GRCm39) missense probably benign 0.44
IGL02738:Dnah1 APN 14 31,014,597 (GRCm39) missense probably benign 0.27
IGL02863:Dnah1 APN 14 31,017,250 (GRCm39) missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31,022,828 (GRCm39) missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 30,988,674 (GRCm39) missense probably benign 0.40
IGL03201:Dnah1 APN 14 31,022,906 (GRCm39) missense probably benign 0.13
IGL03215:Dnah1 APN 14 30,996,348 (GRCm39) missense probably damaging 1.00
IGL03230:Dnah1 APN 14 30,992,023 (GRCm39) missense probably damaging 1.00
IGL03248:Dnah1 APN 14 30,991,846 (GRCm39) missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31,008,545 (GRCm39) missense probably benign 0.00
IGL03299:Dnah1 APN 14 31,037,079 (GRCm39) nonsense probably null
IGL03301:Dnah1 APN 14 31,014,649 (GRCm39) missense probably damaging 1.00
ergonomic UTSW 14 31,022,705 (GRCm39) missense possibly damaging 0.91
Faraday UTSW 14 31,032,839 (GRCm39) missense probably null 0.05
K3955:Dnah1 UTSW 14 30,988,416 (GRCm39) missense probably benign
PIT1430001:Dnah1 UTSW 14 30,984,537 (GRCm39) missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31,006,412 (GRCm39) missense probably damaging 1.00
R0043:Dnah1 UTSW 14 30,996,362 (GRCm39) missense probably damaging 0.97
R0092:Dnah1 UTSW 14 30,993,566 (GRCm39) missense probably benign 0.00
R0100:Dnah1 UTSW 14 30,984,109 (GRCm39) critical splice donor site probably null
R0100:Dnah1 UTSW 14 30,984,109 (GRCm39) critical splice donor site probably null
R0101:Dnah1 UTSW 14 31,005,856 (GRCm39) missense probably damaging 1.00
R0119:Dnah1 UTSW 14 30,998,115 (GRCm39) missense probably damaging 1.00
R0136:Dnah1 UTSW 14 30,998,115 (GRCm39) missense probably damaging 1.00
R0144:Dnah1 UTSW 14 30,989,831 (GRCm39) splice site probably benign
R0279:Dnah1 UTSW 14 31,024,332 (GRCm39) missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 30,998,115 (GRCm39) missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31,000,108 (GRCm39) missense probably benign 0.00
R0739:Dnah1 UTSW 14 30,987,872 (GRCm39) nonsense probably null
R0789:Dnah1 UTSW 14 31,026,548 (GRCm39) missense probably benign
R0826:Dnah1 UTSW 14 31,025,864 (GRCm39) missense probably benign 0.02
R1102:Dnah1 UTSW 14 31,018,414 (GRCm39) nonsense probably null
R1116:Dnah1 UTSW 14 31,029,824 (GRCm39) missense probably benign 0.13
R1229:Dnah1 UTSW 14 31,032,808 (GRCm39) missense probably benign 0.11
R1447:Dnah1 UTSW 14 31,028,855 (GRCm39) missense probably benign 0.06
R1449:Dnah1 UTSW 14 30,985,908 (GRCm39) missense probably damaging 1.00
R1462:Dnah1 UTSW 14 30,990,738 (GRCm39) splice site probably benign
R1482:Dnah1 UTSW 14 31,016,831 (GRCm39) missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31,038,715 (GRCm39) missense probably benign
R1512:Dnah1 UTSW 14 31,014,994 (GRCm39) missense probably damaging 1.00
R1591:Dnah1 UTSW 14 30,994,289 (GRCm39) missense probably benign 0.01
R1598:Dnah1 UTSW 14 31,023,219 (GRCm39) missense probably benign 0.07
R1644:Dnah1 UTSW 14 31,024,249 (GRCm39) splice site probably benign
R1672:Dnah1 UTSW 14 30,998,157 (GRCm39) missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31,001,139 (GRCm39) missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31,032,839 (GRCm39) missense probably null 0.05
R1796:Dnah1 UTSW 14 30,983,050 (GRCm39) missense probably benign 0.00
R1902:Dnah1 UTSW 14 31,041,716 (GRCm39) missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31,041,716 (GRCm39) missense probably damaging 0.99
R1905:Dnah1 UTSW 14 30,986,587 (GRCm39) missense probably benign 0.06
R1908:Dnah1 UTSW 14 30,984,515 (GRCm39) missense probably damaging 1.00
R1972:Dnah1 UTSW 14 30,987,348 (GRCm39) nonsense probably null
R1973:Dnah1 UTSW 14 30,987,348 (GRCm39) nonsense probably null
R2004:Dnah1 UTSW 14 31,023,813 (GRCm39) missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31,001,080 (GRCm39) missense probably damaging 1.00
R2062:Dnah1 UTSW 14 30,993,086 (GRCm39) missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31,001,121 (GRCm39) missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31,021,931 (GRCm39) missense probably benign 0.00
R2862:Dnah1 UTSW 14 31,006,719 (GRCm39) missense probably benign 0.21
R2894:Dnah1 UTSW 14 31,020,718 (GRCm39) missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 30,988,779 (GRCm39) nonsense probably null
R3410:Dnah1 UTSW 14 30,991,774 (GRCm39) missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 30,991,774 (GRCm39) missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31,038,631 (GRCm39) missense probably damaging 0.96
R3616:Dnah1 UTSW 14 31,037,105 (GRCm39) missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 30,987,424 (GRCm39) splice site probably benign
R3805:Dnah1 UTSW 14 31,016,720 (GRCm39) missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31,028,985 (GRCm39) missense probably benign
R4007:Dnah1 UTSW 14 31,025,741 (GRCm39) splice site probably benign
R4201:Dnah1 UTSW 14 30,984,227 (GRCm39) missense probably benign 0.00
R4232:Dnah1 UTSW 14 31,026,873 (GRCm39) missense probably benign
R4372:Dnah1 UTSW 14 31,026,879 (GRCm39) missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31,016,792 (GRCm39) missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31,006,718 (GRCm39) missense probably benign 0.00
R4526:Dnah1 UTSW 14 31,007,955 (GRCm39) missense probably benign 0.05
R4650:Dnah1 UTSW 14 31,006,844 (GRCm39) splice site probably null
R4723:Dnah1 UTSW 14 30,994,899 (GRCm39) missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31,041,902 (GRCm39) missense probably benign
R4783:Dnah1 UTSW 14 30,985,436 (GRCm39) missense probably damaging 1.00
R4784:Dnah1 UTSW 14 30,985,436 (GRCm39) missense probably damaging 1.00
R4785:Dnah1 UTSW 14 30,985,436 (GRCm39) missense probably damaging 1.00
R4843:Dnah1 UTSW 14 30,986,920 (GRCm39) missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31,022,705 (GRCm39) missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 30,989,496 (GRCm39) missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31,017,280 (GRCm39) missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31,008,855 (GRCm39) missense probably null 1.00
R5070:Dnah1 UTSW 14 31,004,375 (GRCm39) missense probably benign 0.05
R5128:Dnah1 UTSW 14 31,018,152 (GRCm39) splice site probably null
R5409:Dnah1 UTSW 14 30,985,212 (GRCm39) missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31,038,704 (GRCm39) missense probably benign
R5481:Dnah1 UTSW 14 31,030,828 (GRCm39) missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31,038,665 (GRCm39) missense probably benign 0.00
R5555:Dnah1 UTSW 14 31,012,776 (GRCm39) missense probably damaging 0.99
R5566:Dnah1 UTSW 14 30,996,323 (GRCm39) missense probably benign 0.35
R5623:Dnah1 UTSW 14 31,007,980 (GRCm39) missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 30,996,001 (GRCm39) missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31,032,863 (GRCm39) missense probably benign 0.00
R5823:Dnah1 UTSW 14 30,988,375 (GRCm39) missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 30,989,984 (GRCm39) missense probably damaging 1.00
R6030:Dnah1 UTSW 14 30,989,984 (GRCm39) missense probably damaging 1.00
R6090:Dnah1 UTSW 14 30,991,382 (GRCm39) missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31,007,984 (GRCm39) missense probably benign 0.02
R6145:Dnah1 UTSW 14 31,022,927 (GRCm39) missense probably benign 0.07
R6306:Dnah1 UTSW 14 31,026,544 (GRCm39) missense probably damaging 0.97
R6376:Dnah1 UTSW 14 30,997,565 (GRCm39) missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31,022,765 (GRCm39) missense probably benign 0.08
R6549:Dnah1 UTSW 14 30,991,340 (GRCm39) missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31,021,945 (GRCm39) missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31,008,247 (GRCm39) missense probably benign 0.00
R6870:Dnah1 UTSW 14 30,993,018 (GRCm39) nonsense probably null
R6932:Dnah1 UTSW 14 31,009,733 (GRCm39) missense probably damaging 1.00
R6944:Dnah1 UTSW 14 30,990,861 (GRCm39) missense probably damaging 1.00
R7033:Dnah1 UTSW 14 30,986,882 (GRCm39) missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31,019,067 (GRCm39) missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31,008,033 (GRCm39) missense probably benign
R7136:Dnah1 UTSW 14 31,020,613 (GRCm39) missense probably damaging 1.00
R7203:Dnah1 UTSW 14 30,996,339 (GRCm39) missense probably benign
R7241:Dnah1 UTSW 14 30,986,896 (GRCm39) missense probably benign 0.00
R7260:Dnah1 UTSW 14 30,991,343 (GRCm39) missense probably damaging 1.00
R7264:Dnah1 UTSW 14 30,991,851 (GRCm39) missense probably benign
R7291:Dnah1 UTSW 14 31,020,662 (GRCm39) missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31,009,820 (GRCm39) missense probably damaging 1.00
R7300:Dnah1 UTSW 14 30,991,798 (GRCm39) missense probably benign 0.05
R7319:Dnah1 UTSW 14 31,018,551 (GRCm39) missense probably benign 0.02
R7323:Dnah1 UTSW 14 31,020,664 (GRCm39) missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31,022,748 (GRCm39) missense possibly damaging 0.80
R7472:Dnah1 UTSW 14 30,983,547 (GRCm39) missense probably damaging 1.00
R7499:Dnah1 UTSW 14 31,037,079 (GRCm39) nonsense probably null
R7526:Dnah1 UTSW 14 31,009,833 (GRCm39) missense possibly damaging 0.49
R7560:Dnah1 UTSW 14 31,026,940 (GRCm39) missense probably benign
R7574:Dnah1 UTSW 14 31,041,865 (GRCm39) missense probably benign 0.00
R7617:Dnah1 UTSW 14 31,006,739 (GRCm39) missense possibly damaging 0.80
R7620:Dnah1 UTSW 14 31,025,863 (GRCm39) missense possibly damaging 0.47
R7692:Dnah1 UTSW 14 31,014,295 (GRCm39) missense probably benign 0.00
R7702:Dnah1 UTSW 14 31,032,866 (GRCm39) missense probably benign
R7786:Dnah1 UTSW 14 30,984,478 (GRCm39) missense probably damaging 1.00
R7984:Dnah1 UTSW 14 30,989,772 (GRCm39) missense probably damaging 1.00
R8002:Dnah1 UTSW 14 31,020,679 (GRCm39) missense probably damaging 1.00
R8022:Dnah1 UTSW 14 30,986,971 (GRCm39) missense probably damaging 1.00
R8032:Dnah1 UTSW 14 30,993,505 (GRCm39) missense probably damaging 1.00
R8099:Dnah1 UTSW 14 31,024,321 (GRCm39) missense probably benign 0.00
R8171:Dnah1 UTSW 14 31,019,067 (GRCm39) missense probably damaging 1.00
R8263:Dnah1 UTSW 14 31,015,134 (GRCm39) missense probably damaging 1.00
R8274:Dnah1 UTSW 14 31,017,531 (GRCm39) missense probably benign 0.00
R8345:Dnah1 UTSW 14 30,986,551 (GRCm39) missense probably damaging 1.00
R8348:Dnah1 UTSW 14 31,015,682 (GRCm39) missense probably damaging 1.00
R8353:Dnah1 UTSW 14 31,005,159 (GRCm39) missense probably benign
R8356:Dnah1 UTSW 14 30,994,972 (GRCm39) missense probably benign 0.00
R8376:Dnah1 UTSW 14 31,023,303 (GRCm39) missense probably damaging 1.00
R8448:Dnah1 UTSW 14 31,015,682 (GRCm39) missense probably damaging 1.00
R8461:Dnah1 UTSW 14 31,027,915 (GRCm39) missense probably benign 0.00
R8534:Dnah1 UTSW 14 31,023,805 (GRCm39) missense probably benign 0.16
R8544:Dnah1 UTSW 14 30,990,861 (GRCm39) missense probably damaging 1.00
R8679:Dnah1 UTSW 14 30,989,767 (GRCm39) missense possibly damaging 0.77
R8716:Dnah1 UTSW 14 30,989,941 (GRCm39) critical splice donor site probably benign
R8750:Dnah1 UTSW 14 31,026,924 (GRCm39) missense probably benign 0.30
R8790:Dnah1 UTSW 14 31,018,232 (GRCm39) missense possibly damaging 0.89
R8808:Dnah1 UTSW 14 31,008,771 (GRCm39) missense probably benign
R8821:Dnah1 UTSW 14 31,018,455 (GRCm39) missense probably benign
R8887:Dnah1 UTSW 14 31,032,997 (GRCm39) missense probably damaging 1.00
R8948:Dnah1 UTSW 14 31,012,396 (GRCm39) missense probably damaging 1.00
R8950:Dnah1 UTSW 14 31,012,396 (GRCm39) missense probably damaging 1.00
R8955:Dnah1 UTSW 14 31,007,950 (GRCm39) missense probably benign
R8987:Dnah1 UTSW 14 31,033,704 (GRCm39) missense possibly damaging 0.93
R8998:Dnah1 UTSW 14 31,018,235 (GRCm39) missense probably benign 0.12
R8999:Dnah1 UTSW 14 31,018,235 (GRCm39) missense probably benign 0.12
R9015:Dnah1 UTSW 14 30,986,316 (GRCm39) missense probably damaging 0.96
R9031:Dnah1 UTSW 14 31,001,128 (GRCm39) missense probably benign
R9088:Dnah1 UTSW 14 30,987,970 (GRCm39) missense probably benign 0.04
R9096:Dnah1 UTSW 14 30,983,027 (GRCm39) missense probably damaging 0.99
R9117:Dnah1 UTSW 14 31,033,581 (GRCm39) splice site probably benign
R9157:Dnah1 UTSW 14 30,987,970 (GRCm39) missense probably damaging 0.97
R9296:Dnah1 UTSW 14 30,996,011 (GRCm39) critical splice acceptor site probably null
R9313:Dnah1 UTSW 14 30,987,970 (GRCm39) missense probably damaging 0.97
R9325:Dnah1 UTSW 14 30,998,160 (GRCm39) missense possibly damaging 0.69
R9352:Dnah1 UTSW 14 31,038,620 (GRCm39) missense probably benign 0.00
R9411:Dnah1 UTSW 14 31,018,256 (GRCm39) missense probably damaging 1.00
R9429:Dnah1 UTSW 14 30,997,499 (GRCm39) nonsense probably null
R9452:Dnah1 UTSW 14 31,018,448 (GRCm39) missense probably benign 0.35
R9562:Dnah1 UTSW 14 30,986,394 (GRCm39) missense probably damaging 1.00
R9565:Dnah1 UTSW 14 30,986,394 (GRCm39) missense probably damaging 1.00
R9616:Dnah1 UTSW 14 31,026,400 (GRCm39) missense probably null 0.20
R9621:Dnah1 UTSW 14 31,016,772 (GRCm39) missense probably damaging 1.00
R9677:Dnah1 UTSW 14 31,029,821 (GRCm39) missense probably benign 0.00
R9723:Dnah1 UTSW 14 30,987,946 (GRCm39) missense probably damaging 1.00
R9758:Dnah1 UTSW 14 30,985,395 (GRCm39) missense probably damaging 0.98
RF006:Dnah1 UTSW 14 31,029,832 (GRCm39) missense probably benign 0.08
Z1088:Dnah1 UTSW 14 31,026,768 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGATCCTTGGACTGCATCAC -3'
(R):5'- TCTTCTAGACCAGTTTAGGACCTC -3'

Sequencing Primer
(F):5'- GGGGATTTCAACAGATATTTCAGCCC -3'
(R):5'- CCTGTAACCACCTGACCTGG -3'
Posted On 2015-02-19