Incidental Mutation 'R3615:Dpysl2'
ID 268448
Institutional Source Beutler Lab
Gene Symbol Dpysl2
Ensembl Gene ENSMUSG00000022048
Gene Name dihydropyrimidinase-like 2
Synonyms DRP2, Crmp2, TOAD-64, Ulip2
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.480) question?
Stock # R3615 (G1)
Quality Score 188
Status Validated
Chromosome 14
Chromosomal Location 67040313-67106137 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67071819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 107 (H107L)
Ref Sequence ENSEMBL: ENSMUSP00000022629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022629]
AlphaFold O08553
Predicted Effect probably damaging
Transcript: ENSMUST00000022629
AA Change: H107L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022629
Gene: ENSMUSG00000022048
AA Change: H107L

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.3e-54 PFAM
Meta Mutation Damage Score 0.2247 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collapsin response mediator protein family. Collapsin response mediator proteins form homo- and hetero-tetramers and facilitate neuron guidance, growth and polarity. The encoded protein promotes microtubule assembly and is required for Sema3A-mediated growth cone collapse, and also plays a role in synaptic signaling through interactions with calcium channels. This gene has been implicated in multiple neurological disorders, and hyperphosphorylation of the encoded protein may play a key role in the development of Alzheimer's disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal dendritic patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss21 A G 17: 24,091,805 (GRCm39) T258A probably benign Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Dpysl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Dpysl2 APN 14 67,071,681 (GRCm39) missense probably damaging 1.00
IGL01451:Dpysl2 APN 14 67,045,367 (GRCm39) missense possibly damaging 0.64
IGL02080:Dpysl2 APN 14 67,067,394 (GRCm39) missense probably benign 0.01
IGL02313:Dpysl2 APN 14 67,061,839 (GRCm39) missense probably benign 0.01
IGL02530:Dpysl2 APN 14 67,061,847 (GRCm39) missense probably damaging 1.00
IGL03082:Dpysl2 APN 14 67,045,459 (GRCm39) missense probably damaging 1.00
IGL03357:Dpysl2 APN 14 67,050,736 (GRCm39) missense probably damaging 0.97
R0491:Dpysl2 UTSW 14 67,045,411 (GRCm39) missense probably damaging 1.00
R0564:Dpysl2 UTSW 14 67,042,895 (GRCm39) splice site probably benign
R1121:Dpysl2 UTSW 14 67,100,001 (GRCm39) missense probably benign 0.13
R1190:Dpysl2 UTSW 14 67,061,850 (GRCm39) missense probably benign 0.17
R1595:Dpysl2 UTSW 14 67,052,952 (GRCm39) missense probably damaging 1.00
R1786:Dpysl2 UTSW 14 67,100,114 (GRCm39) splice site probably benign
R1830:Dpysl2 UTSW 14 67,105,840 (GRCm39) unclassified probably benign
R2076:Dpysl2 UTSW 14 67,102,571 (GRCm39) missense probably damaging 1.00
R3616:Dpysl2 UTSW 14 67,071,819 (GRCm39) missense probably damaging 1.00
R3928:Dpysl2 UTSW 14 67,061,880 (GRCm39) missense possibly damaging 0.71
R4209:Dpysl2 UTSW 14 67,052,926 (GRCm39) missense probably damaging 0.98
R4211:Dpysl2 UTSW 14 67,052,926 (GRCm39) missense probably damaging 0.98
R4793:Dpysl2 UTSW 14 67,052,498 (GRCm39) missense possibly damaging 0.93
R4859:Dpysl2 UTSW 14 67,066,888 (GRCm39) missense probably damaging 1.00
R5640:Dpysl2 UTSW 14 67,071,817 (GRCm39) missense probably benign 0.43
R5708:Dpysl2 UTSW 14 67,050,595 (GRCm39) missense probably benign 0.07
R5808:Dpysl2 UTSW 14 67,102,621 (GRCm39) critical splice acceptor site probably null
R7045:Dpysl2 UTSW 14 67,067,395 (GRCm39) missense probably benign 0.06
R7140:Dpysl2 UTSW 14 67,099,982 (GRCm39) missense probably benign 0.00
R7211:Dpysl2 UTSW 14 67,067,425 (GRCm39) missense probably damaging 0.99
R7316:Dpysl2 UTSW 14 67,100,044 (GRCm39) missense possibly damaging 0.94
R7361:Dpysl2 UTSW 14 67,071,664 (GRCm39) missense possibly damaging 0.95
R7772:Dpysl2 UTSW 14 67,066,425 (GRCm39) splice site probably null
R7852:Dpysl2 UTSW 14 67,100,092 (GRCm39) missense probably benign 0.07
R8488:Dpysl2 UTSW 14 67,066,850 (GRCm39) missense possibly damaging 0.84
R8987:Dpysl2 UTSW 14 67,045,402 (GRCm39) missense probably damaging 1.00
R9729:Dpysl2 UTSW 14 67,099,927 (GRCm39) missense probably benign 0.01
R9771:Dpysl2 UTSW 14 67,066,833 (GRCm39) missense probably damaging 1.00
Z1177:Dpysl2 UTSW 14 67,099,939 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCTGTAGTCCCAACTGCC -3'
(R):5'- GCCAAGTTTCTCCCTGTTGG -3'

Sequencing Primer
(F):5'- ACACGCTTGCTCGAGGAAG -3'
(R):5'- GGTGCTCAGTTGGCTTAAGTGC -3'
Posted On 2015-02-19