Incidental Mutation 'R3615:Prss21'
ID268452
Institutional Source Beutler Lab
Gene Symbol Prss21
Ensembl Gene ENSMUSG00000024116
Gene Nameprotease, serine 21
SynonymsmT4, testisin, TESP5, 1700023E12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3615 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23868056-23873114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23872831 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 258 (T258A)
Ref Sequence ENSEMBL: ENSMUSP00000024928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024928]
Predicted Effect probably benign
Transcript: ENSMUST00000024928
AA Change: T258A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024928
Gene: ENSMUSG00000024116
AA Change: T258A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 54 291 1.18e-94 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell-surface anchored serine protease, which is a member of the trypsin family of serine proteases. The encoded protein is predicted to be active on peptide linkages involving the carboxyl group of lysine or arginine. The encoded protein localizes to the cytoplasm and the plasma membrane of premeiotic testicular germ cells and may be involved in progression of testicular tumors of germ cell origin. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for one knock-out allele impaires fertilization of epididymal sperm only in an in vitro experiment. Mice homozygous for another knock-out allele exhibit defective sperm maturation during passage through the epididymis and decreased spermfertilization capability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dpysl2 T A 14: 66,834,370 H107L probably damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Gm597 T C 1: 28,776,575 D792G probably benign Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Krt25 A C 11: 99,317,298 V368G possibly damaging Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp10 A G 7: 108,924,476 F599S probably benign Het
Nlrp12 T A 7: 3,240,575 M436L probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Wdr20 A G 12: 110,793,939 T420A probably benign Het
Other mutations in Prss21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Prss21 APN 17 23872440 missense possibly damaging 0.48
IGL03151:Prss21 APN 17 23869402 missense probably damaging 0.98
R1136:Prss21 UTSW 17 23872994 missense probably damaging 1.00
R2299:Prss21 UTSW 17 23869589 missense probably benign 0.18
R3616:Prss21 UTSW 17 23872831 missense probably benign 0.20
R4589:Prss21 UTSW 17 23872822 missense possibly damaging 0.96
R5691:Prss21 UTSW 17 23868785 splice site probably null
R6946:Prss21 UTSW 17 23868164 missense possibly damaging 0.92
R7835:Prss21 UTSW 17 23869451 missense possibly damaging 0.57
R8243:Prss21 UTSW 17 23869402 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGGCCTCATTTCATCTCAGG -3'
(R):5'- TCAACAGGAGGCCATCAGAG -3'

Sequencing Primer
(F):5'- GGATTTAGACAATGGCCCCACTTTG -3'
(R):5'- TCAGGCAGGCCTCAGCAAAG -3'
Posted On2015-02-19