Incidental Mutation 'R3615:Prss21'
ID 268452
Institutional Source Beutler Lab
Gene Symbol Prss21
Ensembl Gene ENSMUSG00000024116
Gene Name serine protease 21
Synonyms TESP5, mT4, 1700023E12Rik, testisin
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R3615 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 24087046-24092087 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24091805 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 258 (T258A)
Ref Sequence ENSEMBL: ENSMUSP00000024928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024928]
AlphaFold Q9JHJ7
Predicted Effect probably benign
Transcript: ENSMUST00000024928
AA Change: T258A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024928
Gene: ENSMUSG00000024116
AA Change: T258A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 54 291 1.18e-94 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell-surface anchored serine protease, which is a member of the trypsin family of serine proteases. The encoded protein is predicted to be active on peptide linkages involving the carboxyl group of lysine or arginine. The encoded protein localizes to the cytoplasm and the plasma membrane of premeiotic testicular germ cells and may be involved in progression of testicular tumors of germ cell origin. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for one knock-out allele impaires fertilization of epididymal sperm only in an in vitro experiment. Mice homozygous for another knock-out allele exhibit defective sperm maturation during passage through the epididymis and decreased spermfertilization capability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,257 (GRCm39) T818A probably benign Het
Aasdh A G 5: 77,036,629 (GRCm39) V304A probably benign Het
Angptl3 G A 4: 98,922,702 (GRCm39) A248T probably benign Het
Ap2b1 T A 11: 83,215,391 (GRCm39) C112S possibly damaging Het
Aqr A T 2: 113,967,368 (GRCm39) I549N probably damaging Het
Barhl1 C T 2: 28,801,562 (GRCm39) D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 (GRCm39) V821A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dnah1 A G 14: 31,037,105 (GRCm39) L247P possibly damaging Het
Dpysl2 T A 14: 67,071,819 (GRCm39) H107L probably damaging Het
Dzip3 A G 16: 48,757,426 (GRCm39) L869S probably damaging Het
Efs T C 14: 55,157,552 (GRCm39) Y160C probably damaging Het
Enam A T 5: 88,652,306 (GRCm39) N1197Y possibly damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fam184b A G 5: 45,740,157 (GRCm39) V343A possibly damaging Het
Fbxw26 A T 9: 109,572,828 (GRCm39) Y105* probably null Het
Fiz1 A G 7: 5,011,171 (GRCm39) L449P probably benign Het
Foxi2 T A 7: 135,012,180 (GRCm39) C23S possibly damaging Het
Gdf2 G A 14: 33,666,914 (GRCm39) R212Q probably damaging Het
Gm5105 C A 3: 137,755,449 (GRCm39) A46S unknown Het
Grik5 C T 7: 24,721,996 (GRCm39) A581T probably benign Het
Gse1 C G 8: 121,299,481 (GRCm39) probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Krt25 A C 11: 99,208,124 (GRCm39) V368G possibly damaging Het
Lacc1 A G 14: 77,270,727 (GRCm39) V269A probably benign Het
Lamc1 T C 1: 153,126,896 (GRCm39) K417E probably damaging Het
Miip A G 4: 147,950,371 (GRCm39) M75T probably benign Het
Nlrp10 A G 7: 108,523,683 (GRCm39) F599S probably benign Het
Nlrp12 T A 7: 3,289,205 (GRCm39) M436L probably benign Het
Or4b13 T C 2: 90,082,753 (GRCm39) E193G possibly damaging Het
Pafah1b1 G A 11: 74,581,058 (GRCm39) S57F probably damaging Het
Pla2g2e G A 4: 138,607,685 (GRCm39) V22I probably benign Het
Plekhd1 A G 12: 80,764,044 (GRCm39) E202G probably damaging Het
Prss34 A G 17: 25,517,820 (GRCm39) E65G probably benign Het
Psap A G 10: 60,130,383 (GRCm39) N149S probably benign Het
Ptprf C T 4: 118,095,080 (GRCm39) A275T probably benign Het
Sem1 A G 6: 6,578,520 (GRCm39) L12P probably damaging Het
Sf3b3 A G 8: 111,571,155 (GRCm39) Y4H probably damaging Het
Sh3bp4 G T 1: 89,065,427 (GRCm39) R7L probably damaging Het
Slc16a1 T A 3: 104,560,886 (GRCm39) L397Q probably damaging Het
Smg5 A G 3: 88,243,758 (GRCm39) S10G possibly damaging Het
Spata31e5 T C 1: 28,815,656 (GRCm39) D792G probably benign Het
Spata31g1 A G 4: 42,971,864 (GRCm39) N399S probably benign Het
Tas2r102 C T 6: 132,739,781 (GRCm39) Q230* probably null Het
Tdo2 A G 3: 81,882,735 (GRCm39) Y13H possibly damaging Het
Tmem231 C T 8: 112,644,945 (GRCm39) R187H possibly damaging Het
Tmem30b A G 12: 73,592,353 (GRCm39) M254T probably damaging Het
Trpm1 G A 7: 63,893,318 (GRCm39) G1057R probably damaging Het
Tusc3 A T 8: 39,617,879 (GRCm39) K347N probably damaging Het
Usp36 C T 11: 118,167,585 (GRCm39) probably null Het
Vash2 T C 1: 190,702,616 (GRCm39) Y117C probably damaging Het
Vrk2 A G 11: 26,439,866 (GRCm39) I235T possibly damaging Het
Wdr20 A G 12: 110,760,373 (GRCm39) T420A probably benign Het
Other mutations in Prss21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Prss21 APN 17 24,091,414 (GRCm39) missense possibly damaging 0.48
IGL03151:Prss21 APN 17 24,088,376 (GRCm39) missense probably damaging 0.98
R1136:Prss21 UTSW 17 24,091,968 (GRCm39) missense probably damaging 1.00
R2299:Prss21 UTSW 17 24,088,563 (GRCm39) missense probably benign 0.18
R3616:Prss21 UTSW 17 24,091,805 (GRCm39) missense probably benign 0.20
R4589:Prss21 UTSW 17 24,091,796 (GRCm39) missense possibly damaging 0.96
R5691:Prss21 UTSW 17 24,087,759 (GRCm39) splice site probably null
R6946:Prss21 UTSW 17 24,087,138 (GRCm39) missense possibly damaging 0.92
R7835:Prss21 UTSW 17 24,088,425 (GRCm39) missense possibly damaging 0.57
R8243:Prss21 UTSW 17 24,088,376 (GRCm39) missense probably damaging 0.98
R8421:Prss21 UTSW 17 24,088,342 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGGCCTCATTTCATCTCAGG -3'
(R):5'- TCAACAGGAGGCCATCAGAG -3'

Sequencing Primer
(F):5'- GGATTTAGACAATGGCCCCACTTTG -3'
(R):5'- TCAGGCAGGCCTCAGCAAAG -3'
Posted On 2015-02-19