Incidental Mutation 'R3617:Bahd1'
ID268458
Institutional Source Beutler Lab
Gene Symbol Bahd1
Ensembl Gene ENSMUSG00000040007
Gene Namebromo adjacent homology domain containing 1
SynonymsLOC228536
MMRRC Submission 040674-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3617 (G1)
Quality Score205
Status Validated
Chromosome2
Chromosomal Location118900377-118924528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118922523 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 757 (R757H)
Ref Sequence ENSEMBL: ENSMUSP00000043130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036578] [ENSMUST00000099546] [ENSMUST00000110837]
Predicted Effect probably damaging
Transcript: ENSMUST00000036578
AA Change: R757H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043130
Gene: ENSMUSG00000040007
AA Change: R757H

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 564 579 N/A INTRINSIC
BAH 616 771 1.17e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099546
SMART Domains Protein: ENSMUSP00000099579
Gene: ENSMUSG00000074916

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 139 365 1.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110837
SMART Domains Protein: ENSMUSP00000106461
Gene: ENSMUSG00000074916

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 135 340 1.5e-41 PFAM
Meta Mutation Damage Score 0.8159 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,679,289 V460A probably damaging Het
Aplf T C 6: 87,671,883 I25V possibly damaging Het
Ascc3 A G 10: 50,618,185 T239A probably benign Het
Cbfa2t2 A T 2: 154,436,984 probably benign Het
Cdkn1c C T 7: 143,459,794 probably benign Het
Cfap46 A G 7: 139,639,599 S1317P probably benign Het
Cntln C T 4: 85,004,977 Q560* probably null Het
Cntn2 G C 1: 132,528,623 A161G probably benign Het
Crybg1 A G 10: 43,956,786 I1991T possibly damaging Het
Cttnbp2 T C 6: 18,414,190 E952G probably damaging Het
Dhx36 T C 3: 62,472,007 T887A possibly damaging Het
Dhx36 A G 3: 62,487,060 F512L probably benign Het
Fthl17f A G X: 9,063,623 T153A probably benign Het
Gad1-ps T A 10: 99,445,398 noncoding transcript Het
Gba2 C T 4: 43,573,803 R163H probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm17019 A T 5: 15,031,067 M120K possibly damaging Het
Gm8251 T C 1: 44,060,954 D328G probably benign Het
Helz2 C T 2: 181,233,061 R1880H probably damaging Het
Ifi204 T C 1: 173,755,717 I312V possibly damaging Het
Kncn T C 4: 115,885,892 F55L probably benign Het
Kndc1 G A 7: 139,902,060 probably benign Het
Nat8f3 C A 6: 85,761,688 A31S probably benign Het
Ndst4 T C 3: 125,438,133 I117T probably benign Het
Ndufa9 G T 6: 126,849,108 probably benign Het
Nupl2 T C 5: 24,182,327 S372P probably benign Het
Pde6a A G 18: 61,231,503 probably benign Het
Pigw T C 11: 84,878,307 I65M probably damaging Het
Pip A G 6: 41,851,937 T139A probably benign Het
Rel A T 11: 23,745,780 D202E probably damaging Het
Rhot2 A G 17: 25,840,981 probably benign Het
Sh3rf3 G A 10: 59,086,863 R587Q possibly damaging Het
Sim1 T A 10: 50,909,528 M231K probably damaging Het
Slc12a9 G A 5: 137,332,497 T47M probably damaging Het
Slc4a4 A G 5: 89,234,804 D1036G probably benign Het
Tas2r143 A T 6: 42,401,063 I276F probably benign Het
Tgfbr3 A T 5: 107,140,619 F392Y possibly damaging Het
Tmem266 T C 9: 55,400,634 V148A probably damaging Het
Ubiad1 A G 4: 148,436,360 I269T probably benign Het
Vwc2l A G 1: 70,728,882 probably null Het
Zbtb49 G A 5: 38,200,631 probably benign Het
Other mutations in Bahd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Bahd1 APN 2 118917205 missense probably benign 0.01
IGL02425:Bahd1 APN 2 118919164 missense probably benign 0.00
IGL02548:Bahd1 APN 2 118917045 missense possibly damaging 0.79
IGL03024:Bahd1 APN 2 118916116 missense probably damaging 1.00
R0932:Bahd1 UTSW 2 118915927 missense probably damaging 1.00
R1737:Bahd1 UTSW 2 118915923 missense probably damaging 1.00
R2845:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2846:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2899:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2900:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2966:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2985:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2986:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3017:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3018:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3019:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3020:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3021:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3033:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3040:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3431:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3432:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4319:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4394:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4395:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4418:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4456:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4462:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4484:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R5537:Bahd1 UTSW 2 118915980 missense probably damaging 0.96
R5556:Bahd1 UTSW 2 118916270 missense probably damaging 1.00
R6490:Bahd1 UTSW 2 118917138 missense probably benign 0.01
R6736:Bahd1 UTSW 2 118915975 missense possibly damaging 0.54
R7604:Bahd1 UTSW 2 118916310 missense probably benign
Z1176:Bahd1 UTSW 2 118922403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCAGCTCAGTGTTAGG -3'
(R):5'- GCTGAGGGTCTAGATACCTTTCTC -3'

Sequencing Primer
(F):5'- GGAAGAAATTGGTTTCCTTGAAAGC -3'
(R):5'- GAGGGTCTAGATACCTTTCTCATATC -3'
Posted On2015-02-19