Mutagenetix > Incidental Mutations

Incidental Mutation 'R3617:Ndst4'

268462

Institutional Source

Beutler Lab

Gene Symbol

Ndst4

Ensembl Gene

ENSMUSG00000027971

Gene Name

N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4

Synonyms

MMRRC Submission

040674-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R3617 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125404076-125728899 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125438133 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 117 (I117T)

Ref Sequence

ENSEMBL: ENSMUSP00000133341 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173932]

Predicted Effect

probably benign
Transcript: ENSMUST00000144344

SMART Domains

Protein: ENSMUSP00000120687
Gene: ENSMUSG00000027971

Domain	Start	End	E-Value	Type
Pfam:HSNSD	19	505	1.3e-270	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147016

Predicted Effect

probably benign
Transcript: ENSMUST00000173932
AA Change: I117T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133341
Gene: ENSMUSG00000027971
AA Change: I117T

Domain	Start	End	E-Value	Type
Pfam:HSNSD	20	505	1.2e-251	PFAM
Pfam:Sulfotransfer_1	594	857	1.2e-43	PFAM

Meta Mutation Damage Score

0.1688

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

98% (41/42)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit a phenotype restricted to the colonic epithelium that includes an increased number of colon goblet cells, a decreased number of colonocytes, and increased apoptosis of colonic epithelial cells in the proximal colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,679,289	V460A	probably damaging	Het
Aplf	T	C	6: 87,671,883	I25V	possibly damaging	Het
Ascc3	A	G	10: 50,618,185	T239A	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Cbfa2t2	A	T	2: 154,436,984		probably benign	Het
Cdkn1c	C	T	7: 143,459,794		probably benign	Het
Cfap46	A	G	7: 139,639,599	S1317P	probably benign	Het
Cntln	C	T	4: 85,004,977	Q560*	probably null	Het
Cntn2	G	C	1: 132,528,623	A161G	probably benign	Het
Crybg1	A	G	10: 43,956,786	I1991T	possibly damaging	Het
Cttnbp2	T	C	6: 18,414,190	E952G	probably damaging	Het
Dhx36	T	C	3: 62,472,007	T887A	possibly damaging	Het
Dhx36	A	G	3: 62,487,060	F512L	probably benign	Het
Fthl17f	A	G	X: 9,063,623	T153A	probably benign	Het
Gad1-ps	T	A	10: 99,445,398		noncoding transcript	Het
Gba2	C	T	4: 43,573,803	R163H	probably damaging	Het
Gm10717	A	G	9: 3,025,532	Y39C	probably benign	Het
Gm17019	A	T	5: 15,031,067	M120K	possibly damaging	Het
Gm8251	T	C	1: 44,060,954	D328G	probably benign	Het
Helz2	C	T	2: 181,233,061	R1880H	probably damaging	Het
Ifi204	T	C	1: 173,755,717	I312V	possibly damaging	Het
Kncn	T	C	4: 115,885,892	F55L	probably benign	Het
Kndc1	G	A	7: 139,902,060		probably benign	Het
Nat8f3	C	A	6: 85,761,688	A31S	probably benign	Het
Ndufa9	G	T	6: 126,849,108		probably benign	Het
Nupl2	T	C	5: 24,182,327	S372P	probably benign	Het
Pde6a	A	G	18: 61,231,503		probably benign	Het
Pigw	T	C	11: 84,878,307	I65M	probably damaging	Het
Pip	A	G	6: 41,851,937	T139A	probably benign	Het
Rel	A	T	11: 23,745,780	D202E	probably damaging	Het
Rhot2	A	G	17: 25,840,981		probably benign	Het
Sh3rf3	G	A	10: 59,086,863	R587Q	possibly damaging	Het
Sim1	T	A	10: 50,909,528	M231K	probably damaging	Het
Slc12a9	G	A	5: 137,332,497	T47M	probably damaging	Het
Slc4a4	A	G	5: 89,234,804	D1036G	probably benign	Het
Tas2r143	A	T	6: 42,401,063	I276F	probably benign	Het
Tgfbr3	A	T	5: 107,140,619	F392Y	possibly damaging	Het
Tmem266	T	C	9: 55,400,634	V148A	probably damaging	Het
Ubiad1	A	G	4: 148,436,360	I269T	probably benign	Het
Vwc2l	A	G	1: 70,728,882		probably null	Het
Zbtb49	G	A	5: 38,200,631		probably benign	Het

Other mutations in Ndst4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00920:Ndst4	APN	3	125438211	missense	probably damaging	0.98
IGL00926:Ndst4	APN	3	125561453	missense	probably benign	0.01
IGL01292:Ndst4	APN	3	125438754	missense	probably damaging	1.00
IGL01797:Ndst4	APN	3	125683153	missense	probably damaging	0.99
R0004:Ndst4	UTSW	3	125570826	missense	probably benign	0.03
R0118:Ndst4	UTSW	3	125611561	nonsense	probably null
R0652:Ndst4	UTSW	3	125611539	missense	possibly damaging	0.93
R1437:Ndst4	UTSW	3	125561450	missense	probably damaging	0.97
R1502:Ndst4	UTSW	3	125437758	start gained	probably benign
R1900:Ndst4	UTSW	3	125697895	splice site	probably null
R1960:Ndst4	UTSW	3	125438682	nonsense	probably null
R2249:Ndst4	UTSW	3	125438174	missense	probably benign	0.16
R2334:Ndst4	UTSW	3	125708176	missense	possibly damaging	0.86
R2345:Ndst4	UTSW	3	125708120	missense	possibly damaging	0.95
R3713:Ndst4	UTSW	3	125561505	missense	possibly damaging	0.93
R3715:Ndst4	UTSW	3	125561505	missense	possibly damaging	0.93
R3954:Ndst4	UTSW	3	125437905	missense	probably benign	0.01
R4013:Ndst4	UTSW	3	125683170	missense	probably damaging	1.00
R4035:Ndst4	UTSW	3	125438736	missense	probably damaging	1.00
R4085:Ndst4	UTSW	3	125609482	missense	probably benign
R4496:Ndst4	UTSW	3	125683273	missense	probably damaging	1.00
R4498:Ndst4	UTSW	3	125438358	missense	probably damaging	1.00
R5187:Ndst4	UTSW	3	125437911	missense	probably damaging	0.98
R5233:Ndst4	UTSW	3	125710117	missense	probably damaging	1.00
R5518:Ndst4	UTSW	3	125438456	missense	probably benign
R5575:Ndst4	UTSW	3	125437830	missense	probably benign	0.41
R5687:Ndst4	UTSW	3	125438609	missense	possibly damaging	0.79
R5940:Ndst4	UTSW	3	125561419	splice site	probably benign
R6027:Ndst4	UTSW	3	125713376	missense	probably benign	0.38
R6406:Ndst4	UTSW	3	125438501	missense	probably benign
R6540:Ndst4	UTSW	3	125722152	nonsense	probably null
R6941:Ndst4	UTSW	3	125609511	missense	possibly damaging	0.93
R7108:Ndst4	UTSW	3	125561471	missense	probably damaging	0.96
R7269:Ndst4	UTSW	3	125438358	missense	probably damaging	1.00
R7278:Ndst4	UTSW	3	125438303	missense	probably benign	0.00
R7345:Ndst4	UTSW	3	125714659	missense	probably benign	0.07
R7405:Ndst4	UTSW	3	125683216	missense	probably benign
R7418:Ndst4	UTSW	3	125708151	missense	probably damaging	0.99
R7592:Ndst4	UTSW	3	125570787	missense	probably damaging	0.99
R7714:Ndst4	UTSW	3	125570844	missense	probably benign	0.08
R7955:Ndst4	UTSW	3	125438182	nonsense	probably null
R8070:Ndst4	UTSW	3	125714644	missense	probably damaging	1.00
R8412:Ndst4	UTSW	3	125570790	missense	possibly damaging	0.76
X0027:Ndst4	UTSW	3	125437946	missense	probably benign
Z1177:Ndst4	UTSW	3	125570740	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCGGTCTATAGAGCTGAGAACC -3'
(R):5'- GAGCAGTCCTTCAGAGCTAC -3'

Sequencing Primer
(F):5'- GAGCTGAGAACCATCAAGCCTATTG -3'
(R):5'- AGCAGTCCTTCAGAGCTACGTTATTG -3'

Posted On

2015-02-19