Incidental Mutation 'R3617:Ndst4'
ID268462
Institutional Source Beutler Lab
Gene Symbol Ndst4
Ensembl Gene ENSMUSG00000027971
Gene NameN-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms
MMRRC Submission 040674-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3617 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location125404076-125728899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125438133 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 117 (I117T)
Ref Sequence ENSEMBL: ENSMUSP00000133341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173932]
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000144344
SMART Domains Protein: ENSMUSP00000120687
Gene: ENSMUSG00000027971

DomainStartEndE-ValueType
Pfam:HSNSD 19 505 1.3e-270 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147016
Predicted Effect probably benign
Transcript: ENSMUST00000173932
AA Change: I117T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133341
Gene: ENSMUSG00000027971
AA Change: I117T

DomainStartEndE-ValueType
Pfam:HSNSD 20 505 1.2e-251 PFAM
Pfam:Sulfotransfer_1 594 857 1.2e-43 PFAM
Meta Mutation Damage Score 0.1688 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a phenotype restricted to the colonic epithelium that includes an increased number of colon goblet cells, a decreased number of colonocytes, and increased apoptosis of colonic epithelial cells in the proximal colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,679,289 V460A probably damaging Het
Aplf T C 6: 87,671,883 I25V possibly damaging Het
Ascc3 A G 10: 50,618,185 T239A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cbfa2t2 A T 2: 154,436,984 probably benign Het
Cdkn1c C T 7: 143,459,794 probably benign Het
Cfap46 A G 7: 139,639,599 S1317P probably benign Het
Cntln C T 4: 85,004,977 Q560* probably null Het
Cntn2 G C 1: 132,528,623 A161G probably benign Het
Crybg1 A G 10: 43,956,786 I1991T possibly damaging Het
Cttnbp2 T C 6: 18,414,190 E952G probably damaging Het
Dhx36 T C 3: 62,472,007 T887A possibly damaging Het
Dhx36 A G 3: 62,487,060 F512L probably benign Het
Fthl17f A G X: 9,063,623 T153A probably benign Het
Gad1-ps T A 10: 99,445,398 noncoding transcript Het
Gba2 C T 4: 43,573,803 R163H probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm17019 A T 5: 15,031,067 M120K possibly damaging Het
Gm8251 T C 1: 44,060,954 D328G probably benign Het
Helz2 C T 2: 181,233,061 R1880H probably damaging Het
Ifi204 T C 1: 173,755,717 I312V possibly damaging Het
Kncn T C 4: 115,885,892 F55L probably benign Het
Kndc1 G A 7: 139,902,060 probably benign Het
Nat8f3 C A 6: 85,761,688 A31S probably benign Het
Ndufa9 G T 6: 126,849,108 probably benign Het
Nupl2 T C 5: 24,182,327 S372P probably benign Het
Pde6a A G 18: 61,231,503 probably benign Het
Pigw T C 11: 84,878,307 I65M probably damaging Het
Pip A G 6: 41,851,937 T139A probably benign Het
Rel A T 11: 23,745,780 D202E probably damaging Het
Rhot2 A G 17: 25,840,981 probably benign Het
Sh3rf3 G A 10: 59,086,863 R587Q possibly damaging Het
Sim1 T A 10: 50,909,528 M231K probably damaging Het
Slc12a9 G A 5: 137,332,497 T47M probably damaging Het
Slc4a4 A G 5: 89,234,804 D1036G probably benign Het
Tas2r143 A T 6: 42,401,063 I276F probably benign Het
Tgfbr3 A T 5: 107,140,619 F392Y possibly damaging Het
Tmem266 T C 9: 55,400,634 V148A probably damaging Het
Ubiad1 A G 4: 148,436,360 I269T probably benign Het
Vwc2l A G 1: 70,728,882 probably null Het
Zbtb49 G A 5: 38,200,631 probably benign Het
Other mutations in Ndst4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Ndst4 APN 3 125438211 missense probably damaging 0.98
IGL00926:Ndst4 APN 3 125561453 missense probably benign 0.01
IGL01292:Ndst4 APN 3 125438754 missense probably damaging 1.00
IGL01797:Ndst4 APN 3 125683153 missense probably damaging 0.99
R0004:Ndst4 UTSW 3 125570826 missense probably benign 0.03
R0118:Ndst4 UTSW 3 125611561 nonsense probably null
R0652:Ndst4 UTSW 3 125611539 missense possibly damaging 0.93
R1437:Ndst4 UTSW 3 125561450 missense probably damaging 0.97
R1502:Ndst4 UTSW 3 125437758 start gained probably benign
R1900:Ndst4 UTSW 3 125697895 splice site probably null
R1960:Ndst4 UTSW 3 125438682 nonsense probably null
R2249:Ndst4 UTSW 3 125438174 missense probably benign 0.16
R2334:Ndst4 UTSW 3 125708176 missense possibly damaging 0.86
R2345:Ndst4 UTSW 3 125708120 missense possibly damaging 0.95
R3713:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R3715:Ndst4 UTSW 3 125561505 missense possibly damaging 0.93
R3954:Ndst4 UTSW 3 125437905 missense probably benign 0.01
R4013:Ndst4 UTSW 3 125683170 missense probably damaging 1.00
R4035:Ndst4 UTSW 3 125438736 missense probably damaging 1.00
R4085:Ndst4 UTSW 3 125609482 missense probably benign
R4496:Ndst4 UTSW 3 125683273 missense probably damaging 1.00
R4498:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R5187:Ndst4 UTSW 3 125437911 missense probably damaging 0.98
R5233:Ndst4 UTSW 3 125710117 missense probably damaging 1.00
R5518:Ndst4 UTSW 3 125438456 missense probably benign
R5575:Ndst4 UTSW 3 125437830 missense probably benign 0.41
R5687:Ndst4 UTSW 3 125438609 missense possibly damaging 0.79
R5940:Ndst4 UTSW 3 125561419 splice site probably benign
R6027:Ndst4 UTSW 3 125713376 missense probably benign 0.38
R6406:Ndst4 UTSW 3 125438501 missense probably benign
R6540:Ndst4 UTSW 3 125722152 nonsense probably null
R6941:Ndst4 UTSW 3 125609511 missense possibly damaging 0.93
R7108:Ndst4 UTSW 3 125561471 missense probably damaging 0.96
R7269:Ndst4 UTSW 3 125438358 missense probably damaging 1.00
R7278:Ndst4 UTSW 3 125438303 missense probably benign 0.00
R7345:Ndst4 UTSW 3 125714659 missense probably benign 0.07
R7405:Ndst4 UTSW 3 125683216 missense probably benign
R7418:Ndst4 UTSW 3 125708151 missense probably damaging 0.99
R7592:Ndst4 UTSW 3 125570787 missense probably damaging 0.99
R7714:Ndst4 UTSW 3 125570844 missense probably benign 0.08
X0027:Ndst4 UTSW 3 125437946 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCGGTCTATAGAGCTGAGAACC -3'
(R):5'- GAGCAGTCCTTCAGAGCTAC -3'

Sequencing Primer
(F):5'- GAGCTGAGAACCATCAAGCCTATTG -3'
(R):5'- AGCAGTCCTTCAGAGCTACGTTATTG -3'
Posted On2015-02-19